ID: 1089372882

View in Genome Browser
Species Human (GRCh38)
Location 11:117973781-117973803
Sequence GTGAGCACCCAGTAATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089372877_1089372882 0 Left 1089372877 11:117973758-117973780 CCTCTCCTGGGACCAGTGGATGG No data
Right 1089372882 11:117973781-117973803 GTGAGCACCCAGTAATCACAAGG No data
1089372880_1089372882 -5 Left 1089372880 11:117973763-117973785 CCTGGGACCAGTGGATGGGTGAG No data
Right 1089372882 11:117973781-117973803 GTGAGCACCCAGTAATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089372882 Original CRISPR GTGAGCACCCAGTAATCACA AGG Intergenic
No off target data available for this crispr