ID: 1089377095

View in Genome Browser
Species Human (GRCh38)
Location 11:118002148-118002170
Sequence AACCCACATGGGGTTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089377095_1089377107 29 Left 1089377095 11:118002148-118002170 CCATGAAAAACCCCATGTGGGTT No data
Right 1089377107 11:118002200-118002222 GTAGAACAAACCCAGGCCCGCGG No data
1089377095_1089377106 22 Left 1089377095 11:118002148-118002170 CCATGAAAAACCCCATGTGGGTT No data
Right 1089377106 11:118002193-118002215 CCAGTGGGTAGAACAAACCCAGG No data
1089377095_1089377100 7 Left 1089377095 11:118002148-118002170 CCATGAAAAACCCCATGTGGGTT No data
Right 1089377100 11:118002178-118002200 CTCCCCATGCTCAGCCCAGTGGG No data
1089377095_1089377099 6 Left 1089377095 11:118002148-118002170 CCATGAAAAACCCCATGTGGGTT No data
Right 1089377099 11:118002177-118002199 TCTCCCCATGCTCAGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089377095 Original CRISPR AACCCACATGGGGTTTTTCA TGG (reversed) Intergenic