ID: 1089378192

View in Genome Browser
Species Human (GRCh38)
Location 11:118009986-118010008
Sequence CAGTAGCCAGTTGTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089378188_1089378192 14 Left 1089378188 11:118009949-118009971 CCGTGAGGGTGCAGACTCTGCTC No data
Right 1089378192 11:118009986-118010008 CAGTAGCCAGTTGTGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089378192 Original CRISPR CAGTAGCCAGTTGTGGAACT TGG Intergenic
No off target data available for this crispr