ID: 1089380962

View in Genome Browser
Species Human (GRCh38)
Location 11:118031295-118031317
Sequence CACATCTACCACTAAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089380960_1089380962 -8 Left 1089380960 11:118031280-118031302 CCCAATATCAACAGACACATCTA No data
Right 1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG No data
1089380959_1089380962 20 Left 1089380959 11:118031252-118031274 CCACTAGGAGGGCTTGAGGCAGC No data
Right 1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG No data
1089380961_1089380962 -9 Left 1089380961 11:118031281-118031303 CCAATATCAACAGACACATCTAC No data
Right 1089380962 11:118031295-118031317 CACATCTACCACTAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089380962 Original CRISPR CACATCTACCACTAAGATCT TGG Intergenic
No off target data available for this crispr