ID: 1089381418

View in Genome Browser
Species Human (GRCh38)
Location 11:118035538-118035560
Sequence CCTTCTGTTCTGATGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089381418_1089381434 26 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381434 11:118035587-118035609 CCTGCCAGTCTCTAGGGGCCTGG No data
1089381418_1089381427 19 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381427 11:118035580-118035602 GCCTGCCCCTGCCAGTCTCTAGG No data
1089381418_1089381425 -7 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381425 11:118035554-118035576 CAGAAGGACCTGCGTGGGTGGGG No data
1089381418_1089381429 20 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381429 11:118035581-118035603 CCTGCCCCTGCCAGTCTCTAGGG No data
1089381418_1089381430 21 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381430 11:118035582-118035604 CTGCCCCTGCCAGTCTCTAGGGG No data
1089381418_1089381423 -9 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381423 11:118035552-118035574 AACAGAAGGACCTGCGTGGGTGG No data
1089381418_1089381424 -8 Left 1089381418 11:118035538-118035560 CCAGGTGCCATCAGAACAGAAGG No data
Right 1089381424 11:118035553-118035575 ACAGAAGGACCTGCGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089381418 Original CRISPR CCTTCTGTTCTGATGGCACC TGG (reversed) Intergenic
No off target data available for this crispr