ID: 1089385859

View in Genome Browser
Species Human (GRCh38)
Location 11:118067416-118067438
Sequence TAGGGTGAACTGGCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089385852_1089385859 -5 Left 1089385852 11:118067398-118067420 CCACCTGGTTGCCTAAGGTAGGG No data
Right 1089385859 11:118067416-118067438 TAGGGTGAACTGGCCCAGGTGGG No data
1089385854_1089385859 -8 Left 1089385854 11:118067401-118067423 CCTGGTTGCCTAAGGTAGGGTGA No data
Right 1089385859 11:118067416-118067438 TAGGGTGAACTGGCCCAGGTGGG No data
1089385848_1089385859 13 Left 1089385848 11:118067380-118067402 CCTCTTAGGAGCAGGGGGCCACC No data
Right 1089385859 11:118067416-118067438 TAGGGTGAACTGGCCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089385859 Original CRISPR TAGGGTGAACTGGCCCAGGT GGG Intergenic
No off target data available for this crispr