ID: 1089387355

View in Genome Browser
Species Human (GRCh38)
Location 11:118077142-118077164
Sequence ACCAAGGCCTGCCCTGCACT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089387355 Original CRISPR ACCAAGGCCTGCCCTGCACT CGG Exonic
900576545 1:3385403-3385425 GCCAAGCCCTGGCCTGCAGTGGG + Intronic
900993645 1:6109013-6109035 ACCAGGGGGTGCCCTGCACCAGG + Intronic
901497200 1:9629007-9629029 ACCCAGGCCCGCCCCTCACTTGG - Intergenic
902226223 1:14998073-14998095 TCCGAGGCCTGCCCTGCTCCTGG - Intronic
902530534 1:17087866-17087888 CCCAGGGCCTGCCCGGCACATGG + Intronic
905936280 1:41826852-41826874 ACTGAGCCCTGCCATGCACTTGG + Intronic
906025246 1:42667970-42667992 ACCACTGCCTGCTCTGCGCTGGG + Intronic
907158748 1:52356474-52356496 ACCAAGGCAGGTCCTGCTCTGGG - Intronic
908124064 1:61013070-61013092 GCCAAGGCATGCTCTGCTCTTGG - Intronic
910990339 1:93049409-93049431 CCCAAGGCTGGCCCTGAACTGGG + Intergenic
914340287 1:146754362-146754384 ACCAAGGCCTTCTCTGCCTTTGG - Intergenic
914991519 1:152503058-152503080 ACCTATGCCTGCCCAGCTCTGGG - Intergenic
915244054 1:154543874-154543896 ACCAACGCCTGTCCTGCAGGAGG - Intronic
916445150 1:164864969-164864991 ATCTAGTGCTGCCCTGCACTGGG + Intronic
917981123 1:180270059-180270081 AACACGGCCTGCCCTGATCTTGG - Intronic
920267538 1:204735143-204735165 CCCAAGGCCTGGCATGCACCTGG - Intergenic
920401493 1:205679447-205679469 AGGAAGGCCTGACCCGCACTAGG + Intronic
920546502 1:206822794-206822816 AACAAGCCAGGCCCTGCACTAGG - Intronic
920852975 1:209641311-209641333 ACCAAGGACTCCACTGCACATGG - Intronic
921159592 1:212463678-212463700 ACTAGGGCCTTCCCTGCACTGGG + Intergenic
922749997 1:228065803-228065825 ACCAAGCCCCGCCCTGGGCTCGG - Intergenic
1062958238 10:1554142-1554164 ACCAGGGCCTGCCCTGCAGATGG - Intronic
1064418387 10:15169097-15169119 ACCCTGGCCAGCCCTGCACAGGG + Intergenic
1065259955 10:23914004-23914026 ACAGAGGCATGCCCTGCCCTTGG + Intronic
1066313133 10:34217760-34217782 AACAAAGCCTGACCTGCAATAGG - Intronic
1069564639 10:69455224-69455246 ACAAAGGCCTCCTCTGGACTGGG - Intronic
1072805018 10:98418713-98418735 ACCGTGGCCTGCCCTGCAGGGGG + Intronic
1074704432 10:116118544-116118566 ACCAAGGCCTGATCTGAACATGG + Intronic
1076600717 10:131655291-131655313 GCCAAGCTGTGCCCTGCACTTGG + Intergenic
1076720244 10:132389282-132389304 CCCAAGGCCTGGCCAGCACTTGG - Intergenic
1076858317 10:133128052-133128074 ACCCAGACCCGCCCTGCACCTGG + Intronic
1077165219 11:1131736-1131758 ACTGACGCCTGCCCTGCACCGGG + Intergenic
1077287374 11:1773541-1773563 ACCCAGGCCTGTCCAGCCCTGGG - Intergenic
1077462347 11:2716903-2716925 CCCAAGGCCAGGCCTGCAGTAGG + Intronic
1078927741 11:15889829-15889851 ACCAAAGCCTGAGCTGCCCTAGG + Intergenic
1081858127 11:46316686-46316708 CCCAAGCCCTTCCCTGCACAAGG - Intronic
1082691420 11:56308746-56308768 ACACAGGCCTGCCGAGCACTGGG - Intergenic
1083304788 11:61756603-61756625 CCCCACCCCTGCCCTGCACTGGG - Intronic
1084204729 11:67584788-67584810 GCCCATGCCTGCCCTGGACTTGG - Intronic
1084618314 11:70251377-70251399 CCCAAGGCCACCCCTGCCCTTGG + Intergenic
1084658870 11:70535713-70535735 ACCGAGGCCAGCCCTGCAGCAGG + Intronic
1085228764 11:74946714-74946736 ACCCAGGCCTGACCTGACCTTGG - Intronic
1087819444 11:102695276-102695298 ACAAAGGCATGTCCTGGACTTGG - Intronic
1088382842 11:109215866-109215888 ACCAGGGCCTGTCAGGCACTAGG - Intergenic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1090077480 11:123588337-123588359 ACCCAGCCCTGCCCAGCCCTTGG + Intronic
1091003423 11:131930385-131930407 CCCAACTCATGCCCTGCACTCGG + Intronic
1091132866 11:133161014-133161036 CCCAATGCCTGCCCCGCACCAGG - Intronic
1091636809 12:2203376-2203398 ACCAAGGTCTACCCTTCAGTGGG - Intronic
1091718367 12:2795423-2795445 ACCGAGGCCGGCCATGCGCTCGG + Intronic
1092140596 12:6180710-6180732 AGCCAGGCCTGCCCCGCAGTGGG - Intergenic
1092549391 12:9481624-9481646 AACAAGGCCTGTCATGCAGTGGG + Intergenic
1094270672 12:28610944-28610966 GCCAAGGCCCTTCCTGCACTGGG + Intergenic
1094521873 12:31199520-31199542 AACAAGGCCTGTCGTGCAGTGGG - Intergenic
1094569783 12:31631720-31631742 AGCGAGGCCTGCTCTGGACTGGG - Intergenic
1096867850 12:54575835-54575857 CCCAAAGCCTGCCCTGCATTGGG + Intronic
1100814458 12:98372861-98372883 ACCAAAGCCTGCCCTACAGTTGG - Intergenic
1100980774 12:100160723-100160745 ACCAAGGCTGTCCCTGCACCTGG + Intergenic
1101428491 12:104607140-104607162 TCAAAGGCCTGTCCTTCACTGGG - Intronic
1101843378 12:108343115-108343137 AGCAATGCCTGCCCTGGACCTGG + Intergenic
1102096789 12:110247447-110247469 ACCAAGGAGTGCCCTGGAGTAGG + Intergenic
1103006682 12:117426515-117426537 AACAAGACCTTCCCTGCGCTTGG - Intronic
1104633557 12:130424433-130424455 ACCAGGGCCTGGGCTGCACGCGG + Intronic
1104794970 12:131511054-131511076 CCCAAGGCCAGCCCTGGTCTGGG + Intergenic
1104984014 12:132586742-132586764 ACACAGGCCTGCTCTGCCCTGGG + Intergenic
1106809490 13:33346170-33346192 ACCAAGGCCTGCCAACAACTAGG + Intronic
1107774496 13:43823489-43823511 TCTAAGGCCAGCCCAGCACTAGG + Intergenic
1107979165 13:45717904-45717926 GCCAAGACCTGCCCTGCAAGAGG - Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1109209057 13:59513739-59513761 ACCAAGGTTTGGCCTGCTCTGGG - Intergenic
1113692671 13:112322768-112322790 ACCATGGCATGCCCTGTGCTGGG + Intergenic
1113894496 13:113755086-113755108 GCCAAGCCCAGCCCTGCTCTGGG + Intergenic
1114615780 14:24067620-24067642 TCCAAGGCCAACCCAGCACTGGG + Intronic
1114635329 14:24183952-24183974 GGCCAGGCCTGCCCTGCAATGGG - Intronic
1115101245 14:29703318-29703340 ACTAAGCCCTGCGCTGCACAGGG + Intronic
1115918451 14:38343388-38343410 ACCCAAGCCTGCACAGCACTGGG - Intergenic
1117494948 14:56293834-56293856 ACCAAGAACTGCCCTGCAGGAGG + Intronic
1118395239 14:65330542-65330564 ACCCAGGCATGCCCTGCCCCAGG - Intergenic
1119265266 14:73260555-73260577 AAAATGGCCTGCCCTGCACACGG + Intronic
1119825699 14:77655453-77655475 ACCAAGAGCTGCCCTGGGCTTGG + Intergenic
1121802494 14:96786272-96786294 ACCAGCCCCTTCCCTGCACTAGG + Intergenic
1121904593 14:97728143-97728165 TCCAAGGCCTGCCCACCACTAGG - Intergenic
1122155425 14:99747610-99747632 ACCCAGGTCTGCACTGCACCAGG + Intronic
1122691263 14:103533111-103533133 GGCCGGGCCTGCCCTGCACTTGG - Intronic
1124596689 15:31097189-31097211 ATCCAGGCCTGCCCTCCAGTGGG + Intronic
1124983692 15:34584872-34584894 ACCAAATCCTGAGCTGCACTAGG + Intronic
1126104657 15:45139516-45139538 ACCAAGGCCAGGGCAGCACTGGG + Exonic
1126110289 15:45171196-45171218 AGCATGGCCAGCCCTGCCCTGGG - Intronic
1126697960 15:51341652-51341674 GCCAAGCCCTGCCCTGCCCAAGG + Exonic
1128212767 15:65913919-65913941 ACCAAGATCAGCCCAGCACTGGG - Exonic
1128498097 15:68209662-68209684 TCCAGGGCCTGCCCTGCTCCTGG - Exonic
1129293432 15:74585967-74585989 ACCAAGGGCCAGCCTGCACTGGG + Intronic
1129413202 15:75361028-75361050 GCCAAGGCCTGGCCTGACCTGGG + Exonic
1129519633 15:76177642-76177664 TCCATAGCCTGCCCTGCTCTCGG - Intronic
1129708321 15:77807185-77807207 ACCCCGGCATGCCCTGCTCTGGG + Intronic
1129866882 15:78915621-78915643 AACAGAGCCTGGCCTGCACTAGG + Intergenic
1131165902 15:90142020-90142042 ACCAAGGGCTTCCCTGGACAAGG + Intergenic
1131273278 15:90959786-90959808 ACTAAAGCCTGCCCTGCCCAAGG - Intronic
1132143323 15:99412276-99412298 ACCTCAGCCTGCCCTGCCCTTGG - Intergenic
1132481148 16:166710-166732 ACCAAGGCCTGCGCAGCACAGGG - Exonic
1132551558 16:555843-555865 ACCAAGGTCTGCCCCGCGCCAGG - Intergenic
1133153734 16:3856931-3856953 ACTGAGGCCAGCCCTGCCCTGGG - Intronic
1134015600 16:10885903-10885925 ACCATGACCTGGGCTGCACTGGG - Intronic
1135138436 16:19901781-19901803 TCCAAGGCCTTCCCCTCACTCGG - Intergenic
1136274609 16:29171149-29171171 CCCAGGCCCTGCCCTGTACTGGG - Intergenic
1136389257 16:29952021-29952043 TCTAAGGCCAGCCCAGCACTAGG + Intronic
1137604299 16:49776733-49776755 ACCAGGGTCAGCCCAGCACTGGG + Intronic
1138088377 16:54154502-54154524 ACCATGCCCTGCCCTGGGCTTGG - Intergenic
1138144599 16:54597176-54597198 ACACAGGCTTGCCCTGCCCTGGG - Intergenic
1138207178 16:55133649-55133671 CCCAAGGCCTGCCCTGAAAACGG + Intergenic
1138341445 16:56292015-56292037 ACCATTGCCTGCCCTGCCTTCGG + Intronic
1138550259 16:57743949-57743971 ACCAAGGCCTGCCTAGTCCTGGG - Intronic
1139146606 16:64332431-64332453 ACCAATGCCTTCCCTTCCCTAGG + Intergenic
1139994000 16:70963046-70963068 ACCAAGGCCTTCTCTGCCTTTGG + Intronic
1140469050 16:75204643-75204665 CCCAAGGCCTGGCCCTCACTGGG + Intronic
1140582022 16:76241823-76241845 GCCATGGCCTGCCCTGGAGTTGG + Intergenic
1142078894 16:88136793-88136815 CCCAGGCCCTGCCCTGTACTGGG - Intergenic
1142470665 17:161638-161660 CCCAAGCCCTGCCCTGGTCTGGG + Intronic
1142471845 17:169056-169078 ACCTAGCCCTGCCCCGCCCTGGG + Intronic
1142551816 17:745453-745475 ACCAAGGCATGACTTGCACCAGG + Exonic
1142889191 17:2932030-2932052 ATCAACACCTGCTCTGCACTAGG + Intronic
1142973713 17:3630502-3630524 GCCTGGGCCTGCCCTCCACTGGG + Intronic
1143690876 17:8564416-8564438 CCCAAGGCCTGGCCTGCCCACGG + Intronic
1143956400 17:10673460-10673482 ACAAAGGCCTGCCCTGCTTCGGG + Exonic
1144859070 17:18288683-18288705 CCTCAGGCCTACCCTGCACTGGG + Intronic
1145280322 17:21463221-21463243 GCCCAGCCCTGCCCTGAACTCGG - Intergenic
1145898465 17:28474480-28474502 GCCAATGCCTGCCCTGCCCTAGG + Intronic
1147893475 17:43734123-43734145 TCCTAGGCCTGGCCTGCCCTGGG - Intergenic
1148229283 17:45921224-45921246 CCCACGGTCTGCCCTGCACCAGG - Intronic
1149330589 17:55577249-55577271 ACCCAGGCCCGCCCTGCATGCGG + Intergenic
1151667420 17:75553271-75553293 AACAGGGCCTGCCCTGCAAATGG - Intronic
1151818674 17:76484908-76484930 CCCAAGTCCTGACCTGCACAAGG + Intronic
1152330142 17:79668015-79668037 ATCATGCCCTGCACTGCACTAGG - Intergenic
1152688794 17:81708120-81708142 GCCAAGGGCTGCCCAGCACTGGG - Intergenic
1154201943 18:12306302-12306324 ACCAAGGCCTCCCCAGGACATGG - Intergenic
1155254068 18:23979364-23979386 CCCAAGGCCTGCCACTCACTGGG - Intergenic
1155750852 18:29421190-29421212 ACCAAGCCTGTCCCTGCACTTGG + Intergenic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1157244156 18:46038809-46038831 ACCAAGGGTTGCCCAGCCCTTGG - Intronic
1158564423 18:58542770-58542792 ACCTACTCCTGGCCTGCACTTGG - Intronic
1160432821 18:78823615-78823637 GCCAAGACCTGCCCTTCAGTGGG + Intergenic
1160526319 18:79540457-79540479 ACCCACGCCCGCCGTGCACTGGG + Intergenic
1161156951 19:2736947-2736969 ATCAAGGCCTTCACTGAACTTGG + Intronic
1161178826 19:2865887-2865909 ACCAAGACCCGCCCTTCCCTTGG - Intergenic
1162766737 19:12924431-12924453 ACCAGGGCCTACCCTGACCTTGG + Exonic
1163152924 19:15425432-15425454 ACCTGGGCCGGCCCTGCACCTGG + Exonic
1163250343 19:16122993-16123015 ACCAAGCCCTCCCCTGCACCAGG + Intronic
1163296641 19:16417053-16417075 AACAAGGCCTTCCTAGCACTGGG + Intronic
1163773926 19:19206908-19206930 ACCCAGGCTTGCACTGCACCAGG - Intergenic
1164738739 19:30561302-30561324 TCCAAGGTGTGCCCTGCACCTGG + Intronic
1166796656 19:45430184-45430206 CCCAAGGCCTGTCCTGTGCTGGG - Intronic
1167532872 19:50029433-50029455 ACTGCGGCCAGCCCTGCACTGGG + Intronic
1168411537 19:56143235-56143257 ACCAAGTCCAGCTCTTCACTGGG - Intronic
1168645820 19:58058704-58058726 ACCAAAGCCTGCCAGGCGCTAGG - Intergenic
925097673 2:1220260-1220282 ATCAGGGCTTGCCCTGCACTGGG + Intronic
925331485 2:3062287-3062309 ACAAATGCCTGCTCTGCACTGGG - Intergenic
926938165 2:18106976-18106998 TACAATGCCTGACCTGCACTAGG + Intronic
927510681 2:23642256-23642278 ACCATCCCCGGCCCTGCACTGGG - Intronic
932562638 2:72887024-72887046 TCCAGGGCAGGCCCTGCACTGGG - Intergenic
932590552 2:73064123-73064145 CCCAAGGCCTGCTCTTCCCTGGG - Intronic
933663586 2:84946722-84946744 ACCAGGGCCCGGCCTGCAGTGGG + Intergenic
933737315 2:85505575-85505597 ACCAGGACCTCCCCTGCACCAGG + Intergenic
933975059 2:87502800-87502822 AGCAAGACCTGCCCTGAATTGGG + Intergenic
934894267 2:98100370-98100392 ACCAAGGCTGGCACAGCACTGGG + Intronic
935679209 2:105621441-105621463 TCCAAGGTCTTCCCAGCACTGGG - Intergenic
936025145 2:109025991-109026013 ACCAAGGCCTGCCCTCCCTGGGG + Intergenic
936114529 2:109691482-109691504 TCCCAGGACTACCCTGCACTTGG + Intergenic
936318767 2:111448014-111448036 AGCAAGACCTGCCCTGAATTGGG - Intergenic
937207450 2:120245772-120245794 ACCAAGGCCTGGTCCCCACTGGG - Intronic
937230821 2:120397162-120397184 ACCCTGCCCTGCCCTGCCCTGGG + Intergenic
938176881 2:129141855-129141877 ACCAGGCCCTGCCCTGTGCTTGG - Intergenic
940855496 2:158725813-158725835 ACCAATGCCTGGCCAGCGCTGGG + Intergenic
941844350 2:170118427-170118449 ACCAAGCCTGTCCCTGCACTCGG - Intergenic
947652968 2:231802929-231802951 ACAAAGGCCTGGCCTGGGCTGGG - Intronic
948386182 2:237582357-237582379 ACCAAGGCCGGCCCTGTCCGAGG - Intronic
948885057 2:240878222-240878244 ACCCCGGCCTCCCCTGCACCTGG - Intronic
948917333 2:241041145-241041167 ACCCTGGCCTCCCATGCACTCGG - Intronic
949015773 2:241709476-241709498 ACCAAAGCCAGCCTTCCACTTGG - Intronic
1169682526 20:8231729-8231751 ATCAATGACTGCCCTGCACAGGG - Intronic
1169816836 20:9665814-9665836 AGAAATGCTTGCCCTGCACTTGG + Intronic
1170431837 20:16283275-16283297 ACAGTGGCCTGCCCAGCACTGGG - Intronic
1171188626 20:23142152-23142174 ACCAAGTCCTCCCCCGCACAGGG + Intergenic
1172610909 20:36251904-36251926 CCCAGGGACTGCCCTGCACTTGG - Intronic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1174194099 20:48760739-48760761 ACCAGGGCCTGCCGTGCACCAGG + Intronic
1175783747 20:61699351-61699373 CCCAGTGCCCGCCCTGCACTGGG - Intronic
1179600707 21:42475799-42475821 ACCAAGGCCTGCCTTCAGCTGGG - Intronic
1181041126 22:20193128-20193150 GCCACTGCCTGCCCAGCACTGGG + Intergenic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1181928535 22:26380011-26380033 ACCAGGGCATGCCCTGTTCTTGG + Intronic
1183374897 22:37457449-37457471 AGCCAGGCCTGCCTTGCCCTGGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183613622 22:38927828-38927850 ACCAAGGACTGCACAGAACTTGG + Intergenic
1183903077 22:41021081-41021103 TCCAGGTCCTGCCCTGCACTTGG - Intergenic
1184090149 22:42288867-42288889 GCCCAGGCCTGCACTGCCCTTGG - Intronic
1184276768 22:43413096-43413118 AGCCAGGCCAGCCCAGCACTGGG - Intronic
1184919935 22:47598953-47598975 TCCAAGCCCTCGCCTGCACTTGG + Intergenic
1185324657 22:50219756-50219778 ACCACGGCCTGGGCTGCTCTGGG + Exonic
1185376195 22:50483607-50483629 ACCCAGCCCTGCCCTGCCCTGGG - Exonic
949574708 3:5327687-5327709 ACCAAGGCCTGTCCTGGGGTGGG - Intergenic
950857807 3:16121747-16121769 ACCCATTCCTGGCCTGCACTAGG - Intergenic
951156147 3:19355719-19355741 ACCAGGGCCTGTCGTGCAGTGGG + Intronic
952848354 3:37707849-37707871 GGCAAGGGCTGCCCTGCCCTTGG + Intronic
953498744 3:43412448-43412470 ACCGTTGCCTGCACTGCACTGGG + Intronic
954828518 3:53397566-53397588 ACCAGGGCCTGTCCTGGGCTGGG - Intergenic
954974563 3:54680908-54680930 CCCAGGACCAGCCCTGCACTTGG - Intronic
955094444 3:55783182-55783204 ACAAATGCCTGCCCTTCACCTGG + Intronic
957760334 3:84548129-84548151 TCCCAGGCCTGCTCTGCAGTGGG + Intergenic
958256384 3:91330644-91330666 ACAAAGGCCTCCCCTGCACCAGG + Intergenic
958545358 3:95541604-95541626 ACCAGGGCCTGTCGTGCAGTGGG - Intergenic
960277416 3:115743842-115743864 ACCAAGGACTGCCCTGGAAAGGG + Intergenic
961064153 3:123860308-123860330 TACAAGGCCTGCGTTGCACTGGG + Intronic
963004338 3:140711906-140711928 ACCAATGCCTGCACTGGACTAGG - Intergenic
965409282 3:168309781-168309803 ACCAATGTCTGACCTGCCCTTGG + Intergenic
965897860 3:173599520-173599542 ACCAAGGCTAGCCATGTACTTGG - Intronic
966634342 3:182115481-182115503 GCCAAGGCTTGCCTTGCTCTGGG + Intergenic
968582466 4:1401475-1401497 ACCAAGGCCTGCCTGGGGCTTGG + Intergenic
969298261 4:6282033-6282055 ACCACGGCCTGCCCTGGGCCAGG - Intronic
969509734 4:7610891-7610913 ACCAAGACCTGCCCATCACGGGG - Intronic
970670040 4:18386187-18386209 ACAAAGGCCTGGTCTCCACTGGG - Intergenic
972131100 4:35834314-35834336 ACCATGCCCAGCCCTTCACTAGG + Intergenic
972209942 4:36824321-36824343 ACCAAGTCCAGCACTGCACCTGG - Intergenic
972487515 4:39556356-39556378 ACCAAGTCCTTCCCTGCCCCAGG + Intronic
976839773 4:89418595-89418617 AAGAAGGCCTGCTCTACACTGGG - Intergenic
977358902 4:95980304-95980326 TCCAGGGTCTGCCCTGCACTGGG + Intergenic
982292433 4:153792483-153792505 ACCCAGGCCTTCCCTGCTCCGGG + Intergenic
982668983 4:158297663-158297685 ACCAAGCCTGTCCCTGCACTCGG - Intergenic
984945929 4:184968865-184968887 CCCAGGGCCTGCCCTGCCCAGGG - Intergenic
986645626 5:9913620-9913642 ACTGAGGACTGCCCTGAACTTGG - Intergenic
989064404 5:37444993-37445015 CCCAACGCCTGCCGTGCACCTGG + Intronic
990510833 5:56487846-56487868 AGCTCGGCGTGCCCTGCACTCGG + Intergenic
991962799 5:72062634-72062656 ACCAAGGACACTCCTGCACTGGG - Intergenic
993706541 5:91178034-91178056 ACCGAGCCCTGCCTTGCACTTGG - Intergenic
997226118 5:132210699-132210721 GCCCAGCCCTGCCCTGGACTGGG + Intronic
997377019 5:133404641-133404663 ACCCAGGACTGCCATGAACTGGG + Intronic
998167111 5:139850513-139850535 AGCCAGGCCTGCCCAGCACAGGG + Intronic
998179789 5:139928529-139928551 GCCAATGCCTGCCCAACACTTGG - Intronic
1001890307 5:175332905-175332927 ACCATGTCCTGACCAGCACTGGG + Intergenic
1002809014 6:607440-607462 AGCAACACCTGCCCTGCAGTAGG + Intronic
1006413571 6:33890220-33890242 GCCAAGGCCCTCCCTGCTCTTGG + Intergenic
1006582944 6:35087162-35087184 GCCAAGGCCCCACCTGCACTGGG + Intronic
1007396846 6:41582872-41582894 CCCAAGACCTGCCCTGCGGTGGG + Intronic
1008998952 6:57690516-57690538 ACAAAGGCCTCCCCTGCACCAGG - Intergenic
1009187437 6:60589895-60589917 ACAAAGGCCTCCCCTGCACCAGG - Intergenic
1009484530 6:64203297-64203319 GCCAAGGCTTGCCCACCACTTGG - Intronic
1011360588 6:86520085-86520107 GCCTAGGCCTTCCCTGAACTCGG + Intergenic
1012307379 6:97675352-97675374 GCAAAGGCCAGCCCAGCACTTGG + Intergenic
1016385308 6:143525074-143525096 AGCATGGCCTGCTCTGCACAGGG + Intergenic
1018981096 6:168602526-168602548 ACCCAGACCTGCCTTGGACTGGG + Intronic
1019123649 6:169825029-169825051 ACCACCTCCTGCCCTGCCCTGGG + Intergenic
1019291670 7:253559-253581 AACGAAGGCTGCCCTGCACTTGG - Intronic
1020139238 7:5603699-5603721 GCCAAGGCCTGCTCTGTGCTGGG + Intronic
1022328135 7:29351839-29351861 TCCAAGGTCTTCCCTGCACATGG - Intronic
1022471824 7:30686291-30686313 ACCAGGACCAGCCCTGCCCTTGG - Intronic
1023170589 7:37386813-37386835 CCCAAGCCCTTCCCTGCACACGG + Intronic
1023533274 7:41181688-41181710 ACCAAAGTCAGCCCTGAACTTGG - Intergenic
1023816343 7:43953126-43953148 AACAAAGCCTGCTCTGCCCTGGG - Exonic
1023902193 7:44490416-44490438 ACCAAGGCCTGCGCGGCCCCGGG + Exonic
1025023249 7:55496312-55496334 AGCAAGGCCTGCCCTGAAGCTGG + Intronic
1028522560 7:91747835-91747857 ACCAAGGACTGACCTGCCCAAGG + Intronic
1030289530 7:107858511-107858533 ACCAAGCTCAGCCCTGCTCTGGG + Intergenic
1031746617 7:125506299-125506321 ACCAAGGGCTAACCTGCTCTGGG - Intergenic
1034218212 7:149423588-149423610 ACAAAAGCCGGCCCTGCCCTTGG + Intergenic
1034425038 7:151009734-151009756 AACAAGGCCAGCCCGGCAGTGGG - Intronic
1035452822 7:158989440-158989462 ACCAAGTCCTGACCTGTGCTGGG - Intergenic
1036400383 8:8402471-8402493 TCCATGGCTTGGCCTGCACTGGG - Intergenic
1036688015 8:10924584-10924606 ACCCCGGCCTGCCCTCCACCTGG - Intronic
1037500754 8:19483443-19483465 ACCAAGCTCTGCCCTGCCCTAGG + Intronic
1037756717 8:21714993-21715015 ACCAAGGCCTGCACTGCCAGAGG - Intronic
1039885034 8:41649801-41649823 GCCCACGCCTGCCCTGCACGAGG - Intronic
1040555991 8:48478011-48478033 AGCAAGGCCTGGGCTGCAGTAGG + Intergenic
1040776063 8:51044574-51044596 CCCAAGCCCTGCCCTCCACTGGG - Intergenic
1041103333 8:54418205-54418227 ACCCTGCCCTGCCCTGCTCTAGG - Intergenic
1044552152 8:93524587-93524609 TCCAAGGCCTCCCCTGCATGTGG + Intergenic
1049001403 8:139827578-139827600 ACCCAGGCCTGCCATGTGCTGGG + Intronic
1049756802 8:144314369-144314391 CCCAAGACCAGCCCTGCACTGGG - Exonic
1053510747 9:38686122-38686144 ACCCTGTCCTGCGCTGCACTTGG + Intergenic
1054769837 9:69073328-69073350 GCCAAGGTGTGGCCTGCACTGGG + Exonic
1056139840 9:83665087-83665109 AACAAGGCCTGCATTGCTCTAGG + Exonic
1056781919 9:89556643-89556665 ACCATAGACTGCCCTGGACTTGG + Intergenic
1058424513 9:104864764-104864786 ACCCAGGCCACCCCTGCAATGGG + Intronic
1058905731 9:109481218-109481240 GCCATGCCCTGCCCTGCCCTTGG - Intronic
1059698204 9:116748744-116748766 ACCCAGTCCTGCCCTGGACAGGG + Intronic
1061262730 9:129488829-129488851 CCGAAGGCGTGCCCTGCCCTCGG - Intergenic
1061388759 9:130305750-130305772 CCCAAGGCCTGCCCTACTATTGG - Intronic
1061563513 9:131421980-131422002 TCCAAGCCTGGCCCTGCACTCGG + Intronic
1062333545 9:136055108-136055130 ATCCAGGCCTGCCCTGCCCTGGG + Intronic
1062423720 9:136496623-136496645 ACCAGGGCCTGCCCAGCACCCGG - Exonic
1189882707 X:45508777-45508799 CCCAAGGACTGCCCTCCACCTGG - Intergenic
1194468195 X:94257988-94258010 ACCAAAGCAAGCCCTGCACAAGG + Intergenic
1196243096 X:113366417-113366439 ACTAAGCCCAGCCCAGCACTAGG + Intergenic
1196862658 X:120042242-120042264 AACAAGGCCTGCCATGCTGTAGG - Intergenic
1196880444 X:120194102-120194124 AACAAGGCCTGCCATGCTGTAGG + Intergenic
1196903738 X:120411799-120411821 ACCAAGGGCTACCCTGTACCTGG + Intergenic
1197760854 X:130027117-130027139 ACCCGAGCCTGCCCTGCCCTGGG + Intronic
1199064310 X:143396434-143396456 ACCAAGGGCTGCTGTACACTGGG - Intergenic
1199711355 X:150471786-150471808 AGAAATGCCTTCCCTGCACTGGG + Intronic
1200152653 X:153958845-153958867 CCCAGGGGCTGCCCTGCTCTTGG + Intronic
1200213641 X:154357865-154357887 CCCAGGGCCTGGCCAGCACTAGG + Intronic