ID: 1089387765

View in Genome Browser
Species Human (GRCh38)
Location 11:118079316-118079338
Sequence CTGTGGGGATGGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 0, 2: 7, 3: 106, 4: 841}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089387765_1089387774 0 Left 1089387765 11:118079316-118079338 CCTACCTCCTTCCATCCCCACAG 0: 1
1: 0
2: 7
3: 106
4: 841
Right 1089387774 11:118079339-118079361 GCCCCTTTCTGTGACAGTCAGGG 0: 1
1: 0
2: 1
3: 19
4: 214
1089387765_1089387773 -1 Left 1089387765 11:118079316-118079338 CCTACCTCCTTCCATCCCCACAG 0: 1
1: 0
2: 7
3: 106
4: 841
Right 1089387773 11:118079338-118079360 GGCCCCTTTCTGTGACAGTCAGG 0: 1
1: 0
2: 0
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089387765 Original CRISPR CTGTGGGGATGGAAGGAGGT AGG (reversed) Intronic
900154983 1:1200329-1200351 CTGTGGGGATGGAGGGTGTGTGG - Intergenic
900574635 1:3376997-3377019 TTCTTGTGATGGAAGGAGGTGGG - Intronic
900859073 1:5212226-5212248 CCATGGGGAGGGAAGGAGGGAGG + Intergenic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
901069742 1:6511255-6511277 CTGTGGGGAGGGGAGGGTGTTGG - Intronic
901139326 1:7018187-7018209 CTCTGGGGATGGATGGAGCGGGG + Intronic
901267589 1:7923485-7923507 CTCTAGGGAAGGAAGGAGGATGG - Intronic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902634147 1:17724201-17724223 ATGTAGGGGTGGAAGGAGGCTGG - Intergenic
902730466 1:18365529-18365551 CTGTGGCGCAGGAAGTAGGTGGG - Exonic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903825908 1:26145724-26145746 ATCTGGTGATTGAAGGAGGTGGG - Intergenic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904565393 1:31425440-31425462 CTGTGGGGAGGGAAGTGGGGCGG + Intronic
904702449 1:32365988-32366010 CTGGAGGAAAGGAAGGAGGTGGG + Intronic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
905018583 1:34793496-34793518 CTTTGGAGGTGGAAGGGGGTGGG + Intronic
905201374 1:36319367-36319389 CTGTGCGGAGGGACAGAGGTGGG + Intronic
905250680 1:36646386-36646408 CTGAGGGGATGGGAGCAGGATGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905844121 1:41212247-41212269 ATGAGTGGATGGAAGGAGTTGGG + Intronic
905893943 1:41533359-41533381 CTGTGGTGGTGGAAGGGGCTAGG - Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906707749 1:47907058-47907080 GCGTGGGGAGGGAAGGAAGTGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907714157 1:56912252-56912274 CTGTGAGGATCCAAGGTGGTGGG + Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
908568473 1:65383619-65383641 CTTTGGGGAGGTAATGAGGTAGG - Intronic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911039123 1:93578433-93578455 CTGTGTGGGTGGAAGAAGATGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913680816 1:121186126-121186148 GGCTGGGGATGGGAGGAGGTCGG - Intronic
914032649 1:143973768-143973790 GGCTGGGGATGGGAGGAGGTCGG - Intergenic
914156797 1:145094199-145094221 GGCTGGGGATGGGAGGAGGTCGG + Intronic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
916168103 1:161981216-161981238 CGGTGGGGAAGGAAGCAGGCAGG + Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918430540 1:184455506-184455528 ATTTGGGGATGGGAGGAGATTGG - Intronic
918515678 1:185360005-185360027 GTGCGGGGCTGGGAGGAGGTAGG - Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
919871246 1:201823133-201823155 CTGTGGTGAGGGATGGAGTTGGG - Exonic
920252001 1:204628073-204628095 CTGTCAGGAAGGAAGGAGGCAGG - Intronic
920302823 1:204999610-204999632 CCGTGGGGAGGGGAGAAGGTAGG - Intronic
920468129 1:206204652-206204674 GGCTGGGGATGGGAGGAGGTCGG - Intronic
920544403 1:206803380-206803402 CTCTGTGGACGGAAGAAGGTAGG + Intronic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922351401 1:224737212-224737234 CTGCGGGGGTGGGAGGGGGTGGG + Intronic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922851461 1:228736608-228736630 ATGTGGGCAGGGAAGGTGGTGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923474988 1:234323728-234323750 ATGGAGGGATGGAAGGAGGGAGG + Exonic
924051582 1:240084926-240084948 CTGTAGGGATGGAAGTGGGTGGG + Intronic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924802282 1:247336252-247336274 GTGGGGGGAGGGAAGGGGGTGGG - Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062951679 10:1508221-1508243 TCCTGGGGATGGATGGAGGTCGG - Intronic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1064909962 10:20390058-20390080 CTGTAGGGATGGGAGGAGACTGG - Intergenic
1065047460 10:21757252-21757274 CTGTAGGGTGGGATGGAGGTGGG - Intronic
1065281809 10:24146747-24146769 CTGTGCTGATGGAAGGAGACAGG + Intronic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1065957082 10:30703499-30703521 CTGTAGGGTGGGAAGGGGGTTGG - Intergenic
1066112207 10:32207463-32207485 CTGGAGTGATGTAAGGAGGTGGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1069993469 10:72328903-72328925 CTGAGGAGGTGGCAGGAGGTTGG + Intergenic
1070148804 10:73792853-73792875 GTGAGGGGATGGAAGGAGGGAGG + Intronic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1070554617 10:77518010-77518032 CTCTGGGGAGGGAACGAGGCTGG - Intronic
1070755259 10:78988050-78988072 GTGTGGGGGTTGAAGGGGGTGGG + Intergenic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1071596644 10:86932664-86932686 TGGAGGGGATGGAAGGAGGGTGG + Exonic
1071766655 10:88673899-88673921 CTGGGGTGATGGAAGGATGCTGG - Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072756958 10:98027990-98028012 GTGTTGGGATGGAATGGGGTTGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073546501 10:104353842-104353864 CTGTGGAGATCGCAGGAGCTGGG - Exonic
1073730452 10:106281373-106281395 CTGTTGCCATGGAAGGAGGACGG + Intergenic
1074059190 10:109949470-109949492 CTATGGGGAGGGAAGAAGGATGG - Intronic
1074134987 10:110618249-110618271 TTGGGTGGATGGAACGAGGTTGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074306651 10:112285288-112285310 CTGTAGGGATGGAATCAGGAAGG + Intronic
1074638294 10:115346266-115346288 CTTAGGGTCTGGAAGGAGGTGGG - Intronic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075736302 10:124666632-124666654 CTGGGGAGATGGGAGGTGGTGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076480009 10:130778765-130778787 CTGTGTGGTTGGATGAAGGTGGG + Intergenic
1076653569 10:132006312-132006334 GTGTGGGGGTGGGAGGGGGTGGG + Intergenic
1076799491 10:132813991-132814013 CTGTGAGGATTCAAGGAGCTGGG + Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077279217 11:1734554-1734576 CTGGGGGGACGGAAGGGGGTGGG - Exonic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077466607 11:2736501-2736523 CTTTGGGGATGGGAGGCGCTAGG + Intronic
1077503151 11:2918247-2918269 TAGAGGGGCTGGAAGGAGGTGGG - Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078137599 11:8664808-8664830 CTGAGGGGATGTCATGAGGTAGG - Intronic
1078528359 11:12117884-12117906 CTGAGGGTCTGGAAAGAGGTTGG - Intronic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1078859228 11:15231991-15232013 CTGTGAGGTAGGAAGGAGGTTGG - Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079238048 11:18703436-18703458 AAGTGGGGAGGGGAGGAGGTGGG - Exonic
1079352554 11:19704020-19704042 TTGGGGGGGTGGAAGGGGGTAGG + Intronic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080613405 11:33925105-33925127 CTGTGGGGATGGAATGTGTAGGG + Intergenic
1081655669 11:44855812-44855834 ATGAGAGGATGGAAGGAGGATGG - Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083553326 11:63607087-63607109 CTGTGCTGATGGAATGAGGTGGG + Intronic
1083692092 11:64415519-64415541 CTGAGGAGAGGGGAGGAGGTGGG + Intergenic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084337720 11:68470607-68470629 CTGTGCTGCTGGAGGGAGGTTGG + Intronic
1084562803 11:69913878-69913900 CTGTGGGGCCGTAAGGAGGAGGG - Intergenic
1084772038 11:71349610-71349632 CTGTGGGGATGGCAGGCCATTGG + Intergenic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1084937820 11:72596396-72596418 GTGTGGGGGTGGGAGGAGTTGGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085043217 11:73338902-73338924 CTGTGGGGATTAAAGGAGCCAGG + Intronic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1085740907 11:79077704-79077726 CTCTGGGGAGGGAAAGAGGTTGG + Intronic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086402471 11:86472093-86472115 GGGTGCGGATGGAAGGAGGGAGG + Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1086601181 11:88636174-88636196 CTGTGGTCAGGAAAGGAGGTTGG - Intronic
1087069526 11:94063786-94063808 CTGTGTGGAGCAAAGGAGGTAGG - Intronic
1087826562 11:102771137-102771159 CTGTAAGGAAGGAAGGAGGGAGG + Intronic
1088588103 11:111377769-111377791 CTGTGTGGATGAGAGCAGGTGGG - Intronic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089011086 11:115132391-115132413 CTTGGGGGATGGAGGGAGTTGGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089353572 11:117835403-117835425 AGTTGGGGCTGGAAGGAGGTGGG + Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089519592 11:119055061-119055083 CTGAGGGGAAGGAAGGTAGTTGG + Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089911531 11:122105565-122105587 CTGTGGGTTTGAAAGGAGCTGGG - Intergenic
1090044022 11:123315344-123315366 CTGAGGGGCTGAAAGGAGGGAGG - Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1090863494 11:130674864-130674886 ATTTGGGGATGGAAGGATGGTGG + Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091084467 11:132707002-132707024 TTCTGGGGATGGAAGAAAGTTGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091693974 12:2615931-2615953 CTGTGTGGAGGGGAGGAGTTAGG - Intronic
1092243023 12:6847100-6847122 CTGTGGGGAGGGAAGGCCATGGG - Exonic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1093884333 12:24441957-24441979 CTTTGTGGATTTAAGGAGGTAGG + Intergenic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1094213581 12:27917982-27918004 CTGGGGGGAGGGGAGGAGATAGG + Intergenic
1094394503 12:29991491-29991513 CAGTGGGGATCCAAGGAGGTTGG + Intergenic
1096218274 12:49810178-49810200 GTGGGGGGAGGGAAGGGGGTGGG + Intronic
1096408720 12:51362173-51362195 CTGTGGGGGAGGAAGCAGGTTGG - Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096742198 12:53702094-53702116 CTGTGGGGATAGGAGGAGATAGG - Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097167103 12:57091706-57091728 CTGGGGGGCTGGCAGCAGGTGGG + Exonic
1097178719 12:57158662-57158684 CCATGGGGATGGAAGGGGGCTGG + Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097500145 12:60391968-60391990 CCATGGGGATGGAAGGAGCTGGG + Intergenic
1098789125 12:74798103-74798125 CTGTGGAGATGGTAAGAGTTGGG + Intergenic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1101725609 12:107385851-107385873 CGGTGAGGATGGCAGGAGGGTGG - Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1101787164 12:107894037-107894059 CTGCGGGGTTGGAAAGAGGGTGG - Intergenic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103740590 12:123088534-123088556 GTGTGGGGGTGGCAGGAGGGTGG + Intronic
1104013657 12:124948897-124948919 CAGGGTGGATGGGAGGAGGTGGG - Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104421223 12:128637224-128637246 CTGTGGGGATTGTAGGCTGTGGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104568177 12:129903580-129903602 CTGTTGGGGTCGAAGGAGGGAGG - Exonic
1104731054 12:131105559-131105581 GTGTGGGCATGGAAGGAGCTGGG + Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1105846374 13:24297692-24297714 CTGTGCAGATGAAAGGAGGCGGG + Exonic
1105959035 13:25312077-25312099 CATTGGGGAAGTAAGGAGGTAGG + Intronic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106570663 13:30924493-30924515 CTGGGGGGAGGGTAGGAGGTGGG + Exonic
1106830430 13:33575500-33575522 CTGTGGTGATGTTGGGAGGTGGG + Intergenic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108357671 13:49642142-49642164 CTGAGGGGAAGGAAGGGTGTGGG - Intergenic
1111831106 13:93330664-93330686 CTGTTGGGAAGAAAGGAGCTGGG - Intronic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112505795 13:99974957-99974979 GTCTGGGGTTGGAAGGAGGTTGG - Intergenic
1112609943 13:100946212-100946234 CTGTGGGGAAGGAATGAGCTTGG - Intergenic
1113574169 13:111382529-111382551 CTGTGGTGATGGGTGGGGGTCGG + Intergenic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1114417973 14:22556851-22556873 CTCCTGGGAGGGAAGGAGGTGGG + Intronic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1116257159 14:42571124-42571146 CTGCAGGGATGGAAGCAGGGAGG - Intergenic
1116539309 14:46079266-46079288 CTGTGTGGTTGAAATGAGGTAGG - Intergenic
1116676193 14:47908916-47908938 CTGTGGTAATGGAAGGTGCTAGG - Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1117221840 14:53613899-53613921 CTGTGGGGAGTGCAGGAGGCTGG - Intergenic
1117391568 14:55267493-55267515 CTGTGGGGATAGGAGGATCTGGG + Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118355787 14:65012507-65012529 CTGTGGCTCTGGCAGGAGGTAGG + Intronic
1118818836 14:69331577-69331599 CTGTAGACATGAAAGGAGGTAGG + Intronic
1119562909 14:75605186-75605208 CTGTGTGGATTGCAGGATGTAGG + Intronic
1120849806 14:89159689-89159711 CTGTGGGGTGGGATGAAGGTGGG + Exonic
1121031201 14:90660026-90660048 CTGTAAAGATGGAATGAGGTGGG + Intronic
1121114731 14:91335618-91335640 CTCTGGGGAGGGAAGCAGGCAGG - Intronic
1121362511 14:93274485-93274507 ATGGAGGGATGGAAGGTGGTAGG + Intronic
1121556157 14:94839364-94839386 CTGATGGGAGGGAAGGAGGAAGG - Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1121898736 14:97672923-97672945 ATGTGGGGCAGGAAGGAGATGGG + Intergenic
1122044990 14:99016971-99016993 TTGTGGGGAGGGCAGGGGGTGGG - Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122466684 14:101938538-101938560 CACTGGGGCGGGAAGGAGGTTGG - Intergenic
1122651691 14:103230071-103230093 CTATGGGGAGGGGAGGAGGGGGG + Intergenic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123119694 14:105910990-105911012 CTTTGGGGAGGGAAGGATGGAGG - Intergenic
1123503624 15:20915485-20915507 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123560871 15:21489159-21489181 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123597110 15:21926450-21926472 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1124212662 15:27776300-27776322 ATGTAGGGATGGCAGGAGGGAGG - Intronic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124480047 15:30070591-30070613 CTCTTGAGAAGGAAGGAGGTTGG + Intergenic
1124584312 15:30991447-30991469 CTGGGGCGGTGGCAGGAGGTAGG + Exonic
1124798800 15:32809472-32809494 GTATGGGGATGGCAGGAGGCAGG - Intronic
1124824981 15:33084708-33084730 CTTGGGGAATGGCAGGAGGTGGG - Intronic
1125537896 15:40453080-40453102 CTGTCGGGTTGGAAGGATGGGGG + Intronic
1125546875 15:40512382-40512404 CTGGGGTGTTGGAAGGAGATTGG - Intergenic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1126103630 15:45134324-45134346 CTCTGGGGAAGGAAGCCGGTGGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126557335 15:50004031-50004053 CTGGGGAGATGGGCGGAGGTGGG - Intronic
1127068586 15:55265794-55265816 CTGAAGGGATGCATGGAGGTAGG + Intronic
1127657733 15:61071533-61071555 CGGTGGGGATGGAAGGGGAGGGG + Intronic
1128334619 15:66777980-66778002 TTGGGGGGATGGAAGGAGTTTGG + Intronic
1128354047 15:66911884-66911906 CTGTGAGGATTAAATGAGGTTGG + Intergenic
1128391794 15:67187319-67187341 CTGTGGGGATGGAAGTGGCCAGG - Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129603109 15:77011829-77011851 CTGTAGGTATGGAAAGAGGGTGG - Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129714565 15:77839686-77839708 GTGTGGAGATGGGAGAAGGTGGG - Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1202969216 15_KI270727v1_random:216323-216345 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132701293 16:1223196-1223218 CCGAGGGGAGGGAAGGAGGGAGG + Intronic
1132754388 16:1475396-1475418 CGGTGGGGAAGGGAGGAGGGAGG + Exonic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133008785 16:2898750-2898772 GGGTGGGGATGGAAGGATGGAGG - Intronic
1133613161 16:7451926-7451948 ATCTGGGTATGGAATGAGGTGGG + Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1136124278 16:28166186-28166208 CTGTAGGGGTGGCAGGAGGTGGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136751162 16:32637585-32637607 CTGCGGGGCTGGATGCAGGTAGG + Intergenic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137763786 16:50961822-50961844 CTGCGGAGATGGGAGGAGGCTGG + Intergenic
1138083745 16:54115539-54115561 CTGTGGGGAAGGGAGGTGGTTGG + Exonic
1138105108 16:54283929-54283951 GTCTGGGGCTGGAAAGAGGTGGG + Intronic
1138954365 16:61952984-61953006 ATGTGAGGATGGTAGGAGGTAGG + Intronic
1139023454 16:62782041-62782063 ACGTGGGGTTGGAAAGAGGTGGG + Intergenic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139558700 16:67728512-67728534 CTGTGGGGAGGGGTTGAGGTGGG + Intronic
1140514231 16:75530599-75530621 CTGTAGGTATGTAAGTAGGTGGG - Exonic
1140869446 16:79093216-79093238 CGGTGTGGTTGGGAGGAGGTGGG + Intronic
1141093725 16:81148182-81148204 CTGTGGGGAGGGAGTCAGGTTGG + Intergenic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141632619 16:85296761-85296783 CTGTAAGAATGGAAGGAGTTAGG - Intergenic
1141670217 16:85487737-85487759 CGGTGGTGGGGGAAGGAGGTGGG + Intergenic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142038769 16:87879103-87879125 CTGTGAGGATGGAAGTTTGTAGG + Intergenic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142155686 16:88531979-88532001 CTGTGGGGTGGGAAGCAGGCGGG - Intronic
1203053296 16_KI270728v1_random:896840-896862 CTGCGGGGCTGGATGCAGGTAGG + Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1142549834 17:732126-732148 CCGCGGGGAAGGAAGGAGGGAGG - Intergenic
1143175785 17:4954099-4954121 GTGTGGGGTTGGAACGAGGCTGG - Intronic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143498896 17:7327509-7327531 GTGTGGGGATGGGAGTAGGGGGG + Exonic
1143643027 17:8210417-8210439 CCGCAGGGCTGGAAGGAGGTAGG - Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144437347 17:15253706-15253728 CGCTGGGGAGGGAAGGAGCTTGG - Intronic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144788101 17:17842864-17842886 CTGTGGGGATGGGAGGAGACAGG + Intergenic
1144839604 17:18177749-18177771 CTGTGGGGATTAAAACAGGTAGG + Intronic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1146478131 17:33179632-33179654 CTGTGGGGTTGTAAGGAGGGTGG - Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147038257 17:37698020-37698042 CTCTAGGGCTGGAAGGAGATCGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148201723 17:45753826-45753848 CTGTGGGTAGGGACTGAGGTGGG + Intergenic
1148201799 17:45754135-45754157 GTGTGGGGGTGGTAGGAGGCTGG - Intergenic
1148469583 17:47884926-47884948 CGGTGGGTAGGGAAGGAGCTGGG - Intergenic
1148583813 17:48762429-48762451 TGGTGGGGATGGGCGGAGGTCGG + Exonic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148734404 17:49857124-49857146 CCATGGGGAGGGAAGGAGGGAGG + Intergenic
1148795714 17:50195719-50195741 CTCTCGGGATGGCAGGAGGAAGG + Intronic
1149102947 17:52928009-52928031 ATGGGGAGATGGAAGGGGGTTGG + Intergenic
1149578022 17:57727668-57727690 CTGCAGGGAAGGAAGGAGGGAGG + Intergenic
1149931099 17:60756413-60756435 ATGTGTGGATGGAAGGGGGGTGG - Intronic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151334638 17:73432647-73432669 AGGTGGGGAGTGAAGGAGGTAGG + Intronic
1151350265 17:73527689-73527711 GAGCGTGGATGGAAGGAGGTAGG + Intronic
1151366898 17:73623457-73623479 CTGGGGGGAAGGAAGGAGTGAGG + Intronic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151521276 17:74632117-74632139 CCGGGAGGATGGAAGGAGGCTGG - Intergenic
1151763431 17:76120354-76120376 CTGTGGGGCAGGAAGGATTTGGG + Intronic
1152336888 17:79703750-79703772 CTGTGGGCATGGAAAGATGCTGG - Intergenic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152641840 17:81452520-81452542 GTGTGTGGATGGTAGGAGGTGGG + Intronic
1152728818 17:81960220-81960242 CTTCGGGGCTGCAAGGAGGTGGG + Intronic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1154948323 18:21183969-21183991 GTGTGGGGATGGGTGGAGGGAGG + Intergenic
1155494467 18:26429096-26429118 CTTTGGAGAGGCAAGGAGGTGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155929313 18:31689320-31689342 CTATGGGGGTGGAAGGTGGGAGG + Intergenic
1156172803 18:34506421-34506443 CGGTGGGGATGGGAGAAGTTGGG + Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156840087 18:41600884-41600906 CTGTGAGGTTGCAATGAGGTTGG + Intergenic
1157029403 18:43887142-43887164 CTGATGGGATGGAATGAGGCTGG - Intergenic
1157542904 18:48524838-48524860 CTGTGAGGAGGCAAGGAGGCAGG - Intergenic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1157823118 18:50788321-50788343 CTGTGGGGATAGAACCAGGCTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158327581 18:56327743-56327765 ATGTGGGGCGGGATGGAGGTTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1158876993 18:61743286-61743308 CTGTAAGGGAGGAAGGAGGTGGG - Intergenic
1158900311 18:61956266-61956288 ATGGGGCAATGGAAGGAGGTAGG - Intergenic
1159948170 18:74458698-74458720 GTGCTGGGATGGATGGAGGTGGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1160321878 18:77904151-77904173 CTGTGGGTAAGGTAGGAGTTTGG - Intergenic
1160367106 18:78335603-78335625 CTATGGGGCTGGAAGGATGGAGG + Intergenic
1160566824 18:79791085-79791107 CTGTGGAGATCGAAGTTGGTAGG + Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1161027446 19:2043083-2043105 CTGTGAGGAGGGAGGGAGCTGGG - Intronic
1161224336 19:3136209-3136231 GGGTGGGGACGGGAGGAGGTGGG - Exonic
1161279052 19:3435190-3435212 CGGAGGACATGGAAGGAGGTAGG + Exonic
1161303744 19:3555978-3556000 CTGTTGGGAGGGCAGGAGGCTGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162341359 19:10093271-10093293 GTGAGGGAATGAAAGGAGGTAGG - Intronic
1162748513 19:12813234-12813256 CTATAGGGAAGGAAGGAGGGAGG + Intronic
1163311829 19:16519512-16519534 ATGTGGGGATGGATGGAGTCAGG - Intronic
1164441096 19:28281617-28281639 GTGTGGGGAAGGAAGGCGGTAGG - Intergenic
1164458294 19:28426995-28427017 AGTTGGGGAAGGAAGGAGGTGGG + Intergenic
1164563524 19:29310082-29310104 CTGTGAGGATTGAAGGAGAAAGG - Intergenic
1164573654 19:29392503-29392525 CTGTGGGCAGGGAAGTGGGTGGG + Intergenic
1164726335 19:30468334-30468356 TTGTGAGGATGGAATGAGGAAGG + Intronic
1164749708 19:30643682-30643704 CTGTGTGGAAGCATGGAGGTGGG + Intronic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149793 19:33753796-33753818 GTGTTGGGATGGTAGGAGGATGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165347480 19:35257914-35257936 ATGTGGGGATGGAAGGGGAGGGG + Intronic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1165833743 19:38742550-38742572 AGGTGAGGATGGAAGGAGGGAGG + Intronic
1166088270 19:40491332-40491354 CTCAGGGGATGGAAGGGGCTAGG + Intronic
1166224080 19:41384103-41384125 GTGGGAGGATGGAAGGGGGTGGG + Intronic
1166708819 19:44924303-44924325 CTGAGGGGTTGGAAGGGGGCAGG - Intergenic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167415084 19:49365724-49365746 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1167461151 19:49625395-49625417 CTCTGGGGAGGGAAGGGGCTGGG - Intronic
1167494763 19:49811257-49811279 CTGAGAGGATAGGAGGAGGTTGG + Intronic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167695770 19:51015025-51015047 TGGTGGGGAAGGAAGGAGTTGGG + Intronic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167918144 19:52759227-52759249 CAGTGAGGTTGGAAGGAGGGTGG + Intergenic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168402150 19:56091598-56091620 GAGTGGGGAAGGCAGGAGGTGGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925315761 2:2921914-2921936 CGGTGGGGAGGGAAGTAGGAAGG + Intergenic
926249095 2:11143417-11143439 CTGAGGGGCTGAAAGGAGGTGGG + Intronic
927058518 2:19390275-19390297 CTATGGGGTTTGAAGGTGGTAGG + Intergenic
927152491 2:20203976-20203998 CTGTGGGGGTGGGAGGTGGCGGG + Exonic
927381929 2:22489260-22489282 CTATGGGTAGGGCAGGAGGTTGG + Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929656307 2:43735434-43735456 GTGGAGGGATGAAAGGAGGTTGG + Intronic
929879042 2:45820883-45820905 CTGGGGGGTGGGAAGGGGGTGGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931750683 2:65327237-65327259 CTGAGGGGATGGGAGCAGGAAGG + Intronic
932585478 2:73025381-73025403 CTGGGGGGATGGAATGTGCTAGG - Intronic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
934621627 2:95813291-95813313 CAGTGGTGATGTAAGGAGGTCGG - Intergenic
934712950 2:96527596-96527618 CGGTGGGGGTGGAATGGGGTGGG + Intergenic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936654832 2:114472911-114472933 CTATGGTGATGGGAGGAGATTGG - Intronic
936970339 2:118170730-118170752 CTGAGGAGATGGATGGAGATTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
937910719 2:127074280-127074302 GTGTGGGGATGGCAGGGTGTGGG - Intronic
938631556 2:133173178-133173200 ATTTGGGGATGGCAGGAGGTTGG + Intronic
939111030 2:138007743-138007765 TTTTGGAGAAGGAAGGAGGTAGG - Intronic
939562898 2:143752678-143752700 CCCTGTGGAAGGAAGGAGGTGGG + Intronic
940268183 2:151862157-151862179 CTTTGGGGATTGAAGCAGGAAGG + Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941903437 2:170698912-170698934 CACTGGGGATGGGAGGAGGGTGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942346444 2:175007336-175007358 ATGTGGGTAGGGAAGGTGGTCGG - Intergenic
942512996 2:176722687-176722709 CAGTGGGGATGGCAGGTGGGAGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944619459 2:201499035-201499057 GTGTGGGGATGGAAGATGGCAGG - Intronic
946160104 2:217830680-217830702 CTCTGAGGAAGGAAGGAGGATGG - Intronic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946475175 2:220000189-220000211 CTGTGGGGTAGGAAGGAGCTGGG - Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946770268 2:223081874-223081896 CCGTGGGGATAGGAGGAGTTTGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947793175 2:232879200-232879222 CCGAGGGGGTGGAAGGGGGTGGG - Exonic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1169054859 20:2612150-2612172 GTGTGGGGTAGGAAGGAGCTAGG - Intronic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169681349 20:8217434-8217456 CCCTGAGGATGGAAGGAGGGAGG + Intronic
1169966101 20:11219126-11219148 CTGTGGGCATGGTAGGACTTCGG + Intergenic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170246022 20:14222488-14222510 GTGAGGGGATGGGAGGAGGGTGG + Intronic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1172672025 20:36641240-36641262 CTGTGACCATGGAAGCAGGTAGG - Exonic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173923222 20:46761601-46761623 CTGTCGGGAAGGAGGGAGCTGGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174789519 20:53464444-53464466 CTGTGAGGAGGGAAGGAGCTTGG + Intronic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175197293 20:57253084-57253106 AAGTGGGGATGGAAGGGGGTGGG - Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175412252 20:58777917-58777939 CTGTGGGGAAGGGTGGAGGCTGG - Intergenic
1175727699 20:61331160-61331182 CACTGGGCATGGAAGGAGATGGG - Intronic
1175779434 20:61672873-61672895 CTGAGGGGAGGGGAAGAGGTGGG + Intronic
1176022746 20:62970504-62970526 CTGCTGGGAGGGAAGGGGGTGGG - Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1177867100 21:26525485-26525507 CTCTGGGGAAGGAAGGCGGCAGG - Intronic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1178421460 21:32446813-32446835 GAGTGGCCATGGAAGGAGGTAGG - Intronic
1178534086 21:33398288-33398310 CTGTGGGTATGGCAGGAGTGGGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178701097 21:34834630-34834652 ATGGGGGGAGGGAAGGAGGGAGG + Intronic
1179884328 21:44306997-44307019 CTGGGGGCAGGGAAGGAGCTGGG + Intronic
1179999557 21:44989165-44989187 CTGTGGGGAGGGGAGAAGTTAGG - Intergenic
1181010062 22:20035045-20035067 CTGTGGGGCTGGAAGTGGGTTGG - Intronic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1181727245 22:24820117-24820139 CTCTGGGGATAGAAGGAGGCTGG + Intronic
1181967435 22:26666878-26666900 GTGTGGGGAAGGAAGGAGCTGGG + Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182096435 22:27629172-27629194 ATGTGACGATGGAAGGAGGAGGG - Intergenic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182122307 22:27796109-27796131 CTGTGGGGGTTGCAGGAGGCAGG - Intronic
1182443416 22:30376965-30376987 CTGTCGGGAGGGAAGCAGGAAGG - Intronic
1182446563 22:30393059-30393081 CTGGGAGGAGGGGAGGAGGTTGG + Intronic
1182474562 22:30569592-30569614 CTTGGGGGAGGGAAAGAGGTAGG + Intronic
1182540625 22:31039209-31039231 CTTACGGGATGGAAGGAGGAGGG - Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182585505 22:31342389-31342411 CAGTGGGGGAGGTAGGAGGTAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182881781 22:33739839-33739861 ATGAGGGCATGGAAGGAGGCGGG + Intronic
1182973238 22:34597352-34597374 CTGTAGGGAAGGAAGGGTGTGGG - Intergenic
1183314502 22:37129463-37129485 CTCTGGGGATGGGAGGCGGAGGG - Intronic
1183689873 22:39382579-39382601 GCGTGGGGATGGTAGGAGGTGGG - Exonic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184042428 22:41952107-41952129 CTCTCAGGATGGCAGGAGGTGGG - Intergenic
1184303437 22:43577783-43577805 ATGTGGGGAGGGAAGGAGTGAGG - Intronic
1185375088 22:50478957-50478979 CTGAGGGGGTGGGAAGAGGTCGG - Intergenic
950443498 3:13023185-13023207 CTGTAGGGATGGAGTGGGGTGGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950668468 3:14511327-14511349 CAGAGGGGATGGAAGGAGCCTGG + Intronic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
951529689 3:23686812-23686834 CTGAGGGGAAAGCAGGAGGTGGG - Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
951855347 3:27190361-27190383 ATCTGGGGAAGGAAGGAAGTAGG + Intronic
952406962 3:33013642-33013664 GTGTGGGGCTGGATGCAGGTGGG + Intronic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
952902095 3:38117321-38117343 CCATGGGGATGAAAGGAGATGGG - Intronic
953191377 3:40691082-40691104 GAGCGGGGATGGAAGGAGGTGGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953746662 3:45579540-45579562 CTTTGGTGCTGGAAGGAGTTGGG + Intronic
953783431 3:45892555-45892577 CCTTGAGGATGGAGGGAGGTAGG + Intronic
953843190 3:46406437-46406459 CTGTGGGGAGGGGAGGCTGTGGG - Intergenic
954387184 3:50250162-50250184 CTGTGGAGATGGCAGTTGGTGGG + Intronic
954425461 3:50440712-50440734 CCAGGGGGATGTAAGGAGGTGGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954887386 3:53887757-53887779 CTGTAGGGATGCAAAGATGTGGG - Intronic
954945980 3:54424749-54424771 ATGTGGGGATGGGAGGATGCAGG - Intronic
955628391 3:60945705-60945727 CTGTGGGGATGGATACAGGTAGG + Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
955959264 3:64322230-64322252 GAGTGTGAATGGAAGGAGGTAGG + Intronic
956159671 3:66335895-66335917 TGGTGGGGAGGGAAGGAGGGAGG + Intronic
956326824 3:68062177-68062199 TTCTGGGGTTGGGAGGAGGTAGG + Intronic
956464518 3:69505855-69505877 CTGTGGGGAAGGCAGCTGGTGGG + Intronic
956564887 3:70625165-70625187 CTGTGGGGATAGAAGCAGATGGG + Intergenic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957578232 3:82036304-82036326 CTGGGGGGAAGGAAGGTGATTGG - Intergenic
959917501 3:111832453-111832475 GAATGGGGATGGAAGGATGTGGG - Intronic
959991761 3:112638858-112638880 CTCTGGGGGTTGAGGGAGGTTGG + Exonic
960044065 3:113179420-113179442 ATCTGGGGATGGAATGATGTAGG - Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960797799 3:121506402-121506424 CTGGGGGAATGTGAGGAGGTTGG - Intronic
961090588 3:124107789-124107811 CATTAGGTATGGAAGGAGGTAGG + Intronic
961156626 3:124685049-124685071 CACTGGGGATGCCAGGAGGTTGG - Intronic
961381783 3:126500240-126500262 CAGTGGGGCTGGAAGTTGGTGGG - Intronic
961384570 3:126516469-126516491 GTGGGGGGATGGTAGGTGGTGGG - Intronic
961640081 3:128359751-128359773 CTGTGAGGATGGAAAGCTGTGGG + Intronic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
964088111 3:152842685-152842707 CTTTGGGAATGGAAGTGGGTAGG + Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964485964 3:157185667-157185689 TGGTGGGGGTGGAAGGAGGGAGG - Intergenic
964538909 3:157757131-157757153 CTGTGGGGTAGGGCGGAGGTGGG + Intergenic
964568335 3:158083233-158083255 CTATGGTGGTGGCAGGAGGTAGG - Intergenic
966044851 3:175535504-175535526 CTGTGGGTATGGTAGGTGTTAGG - Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966557855 3:181284087-181284109 CTGTGCGGCTGGAAGAAGCTGGG - Intergenic
966887948 3:184386992-184387014 CTTTGGGGAGGGAATGAGGGTGG + Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967099145 3:186201466-186201488 CTGTTGGGTGGGAAAGAGGTGGG + Intronic
967738424 3:192979209-192979231 CTCTGGGAAGGGTAGGAGGTAGG + Intergenic
967840037 3:193997831-193997853 CTTAGGAGATGGAAGGAGCTTGG - Intergenic
968005197 3:195237962-195237984 CAGTGGGGAAGGTAGGAGGTAGG - Intronic
968405652 4:337310-337332 CTGTGAGGACGGACTGAGGTCGG + Intergenic
968500115 4:945976-945998 CTATGGGGATGGAAGGAGTCAGG - Intronic
968607328 4:1541685-1541707 GTGTCGGGCTGGGAGGAGGTGGG - Intergenic
968814920 4:2817330-2817352 CAGGGCGGCTGGAAGGAGGTGGG + Intronic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969862775 4:10050868-10050890 ATGTGGGGATGCCTGGAGGTGGG - Intronic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970640876 4:18064654-18064676 CCATGGGGAAGGAAGGAGGGAGG - Intergenic
970780043 4:19726195-19726217 CTGGGGGGATGGCAGTAGTTGGG + Intergenic
971757341 4:30720970-30720992 CAGTGGGGCTGGGAAGAGGTGGG - Exonic
972166991 4:36299046-36299068 CAAAGGGGATGGAATGAGGTGGG - Intronic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973019628 4:45186635-45186657 ATGGAGGGAGGGAAGGAGGTGGG - Intergenic
973188000 4:47353761-47353783 TTATGGGAATGGAAGGAGATGGG - Intronic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974703633 4:65483533-65483555 CGTTAGGGAGGGAAGGAGGTGGG + Intronic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975732283 4:77349099-77349121 CTCTGGGGATGGCAAGTGGTGGG + Intronic
975948976 4:79745027-79745049 CCGGGGGGAAGGAAGGAGGGAGG - Intergenic
976127837 4:81853220-81853242 CTGTGGGTAGGGTAGGAGTTGGG - Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
977432434 4:96947340-96947362 GTGAGAGGATGGGAGGAGGTTGG + Intergenic
977546917 4:98394383-98394405 CTGTGGTAATGGAAGAGGGTGGG + Intronic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
979295776 4:119031136-119031158 ATGTGGGGAAGGCAGGAGGTTGG - Exonic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
981728057 4:147868673-147868695 CAGTGGGGGTGGGAGAAGGTAGG + Intronic
982489765 4:156014927-156014949 ATGTGGGGATGGGAGTGGGTTGG + Intergenic
982712887 4:158775575-158775597 GGATGGGGATGGAAGGAGATGGG + Intronic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984205713 4:176785538-176785560 GAGTGGGGATGTGAGGAGGTGGG - Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
985746523 5:1651689-1651711 AGGTGGGGCTGGAAGAAGGTAGG + Intergenic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985948697 5:3206321-3206343 CCCTGGGGATGGAAGGAGCAGGG - Intergenic
985993850 5:3585191-3585213 ATGGGAGGATGGAAGGAGGGAGG + Intergenic
986316016 5:6586804-6586826 CAGTTTGGAAGGAAGGAGGTGGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
987050333 5:14143323-14143345 CAATGGGGAAGGAAGGAGGGGGG - Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
987323553 5:16792557-16792579 CTGTGGGGAGGGACTGGGGTTGG - Intronic
987490547 5:18575498-18575520 GTGTGGGGCGGGTAGGAGGTGGG + Intergenic
989116855 5:37963616-37963638 GGGTGGGGTTGGAAGGAGGAAGG - Intergenic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
990388137 5:55288704-55288726 CTGGTGGTATGGAAGGAGTTAGG + Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991472232 5:66981479-66981501 CTGCGGTGATGGAAGGATGGGGG + Intronic
992017409 5:72589770-72589792 CTGGGGAGTTGGAAGGAGTTGGG + Intergenic
992397225 5:76379123-76379145 CTCTTGGGATGGAAGGAGGGAGG + Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
993318157 5:86437454-86437476 CTGAAGGAATGGCAGGAGGTGGG + Intergenic
994167860 5:96626566-96626588 CTGAGAAGATGGGAGGAGGTGGG - Intronic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995540086 5:113177085-113177107 GTGTGGGGGTGGGAGCAGGTAGG - Intronic
995603417 5:113823984-113824006 CTGAGGGGATGCAATGAGGCTGG - Intergenic
996339218 5:122417717-122417739 AGGTGGGGAGGGAAGGAGGAAGG - Intronic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996605125 5:125312870-125312892 CTGTTGGGAAGGAATGAGATTGG - Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997398133 5:133580900-133580922 CTGTGCAGATTGAAGGAGGCGGG - Intronic
997526939 5:134559683-134559705 AGGAGGGGGTGGAAGGAGGTGGG + Intronic
997630876 5:135368192-135368214 CAGTGTGGATGCAAGAAGGTTGG + Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997975340 5:138438788-138438810 GTGTGGGCAGGGCAGGAGGTGGG + Intergenic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
998377626 5:141701791-141701813 CTCTGGGGGTGGAACGAAGTGGG - Intergenic
999059719 5:148620357-148620379 CAGTGGGGATGGCAGTAGGAAGG + Intronic
999222107 5:149988902-149988924 CTGTGAGGTGGGAATGAGGTTGG - Intronic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1001923863 5:175622086-175622108 CTCTGGGGAAGGAAGGGGGTTGG - Intergenic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002523686 5:179804649-179804671 CTGCAGGGAAGGAAGGAGGTGGG - Intronic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003672773 6:8174787-8174809 CTGTGGGAGTGAAAGGTGGTGGG + Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860699 6:10319479-10319501 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860708 6:10319509-10319531 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004201806 6:13555464-13555486 CTGTGGGGAGGGAAGAAAATGGG - Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1005312473 6:24571603-24571625 ATGTGGGAATGGGAGGTGGTGGG - Intronic
1005316431 6:24606928-24606950 CTGGGAAGATGGAAGGAGCTGGG + Intronic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1006075997 6:31532912-31532934 CTGGGGGGGAGGAAGGGGGTGGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1007091683 6:39188763-39188785 CTGTGGGGAGGTAAGGACGCGGG - Intergenic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1007915132 6:45554321-45554343 CTGAAGGGAGGGAAGGAGGAGGG + Intronic
1008012986 6:46488939-46488961 CTGTGGAGGTGTGAGGAGGTGGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009560826 6:65240423-65240445 GGGTTGGGAGGGAAGGAGGTGGG - Intronic
1010515271 6:76765538-76765560 CTATGAGGATGGAAGAAAGTCGG + Intergenic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012978452 6:105805023-105805045 CTTGGGGGATGGTGGGAGGTGGG + Intergenic
1013193718 6:107826645-107826667 CTGGGAGGAGGCAAGGAGGTTGG - Intergenic
1013655008 6:112237520-112237542 CTGCTGTGATTGAAGGAGGTAGG + Intronic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1014432595 6:121388511-121388533 CTGCAGGGATGGAAGGAGAGGGG - Intergenic
1015528052 6:134192583-134192605 GAGGGGGGATGGATGGAGGTGGG - Intronic
1015945156 6:138492212-138492234 ATGTGGGGATGGGAGCAGGAGGG + Intronic
1016299523 6:142614640-142614662 CTGTGGAGATGGTTGGAGGGGGG + Intergenic
1016710861 6:147170436-147170458 ATGTGGGGGTTGGAGGAGGTGGG - Intergenic
1017400071 6:154050620-154050642 ATGGGGGGCTGGGAGGAGGTGGG + Intronic
1018396108 6:163379212-163379234 CTGTGAGGAAGGAAGGGGATGGG - Intergenic
1018462318 6:164010104-164010126 GTGCGGGGAGGGAAGGGGGTAGG + Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1019276196 7:177275-177297 CCCTGGGGAGGGAAGGAGCTCGG - Intergenic
1019335731 7:481644-481666 GGGTGGGGAGGGGAGGAGGTTGG - Intergenic
1019378946 7:711704-711726 CTGTGGGGAGGGAAGGCTCTGGG - Intronic
1019477276 7:1249945-1249967 CTGGGGGGAGGGACGGAGGGAGG + Intergenic
1019549615 7:1595420-1595442 CTGGGAGGATGGATGGAGGGAGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020537062 7:9413057-9413079 CACTGGGGATGGGAGCAGGTTGG + Intergenic
1020901549 7:14009652-14009674 CTGAGGGGCTGGATGGAGGGAGG - Intergenic
1021308633 7:19063484-19063506 TTGAGGAGGTGGAAGGAGGTGGG - Intronic
1021496091 7:21276240-21276262 CTCTGGGGAGGGGAGGAGGCTGG - Intergenic
1022313286 7:29218188-29218210 GTGAGGGGGTGGAAGGGGGTGGG - Intronic
1022437046 7:30397501-30397523 CTTTGGGGATAGAATGAGATTGG + Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022957084 7:35390874-35390896 CTGTGGGGACTGAAGGAGCCGGG + Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023675208 7:42621684-42621706 CCCTGGGGATTGAAGGAGCTTGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024356524 7:48418980-48419002 TTCTGGGGATGGAAGGTGGAAGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026174443 7:67983829-67983851 CTTTGGGGGAGGAAGGAGGGAGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027269776 7:76513063-76513085 CCCTGGGGATGGGAGGTGGTGGG - Intronic
1027320487 7:77006958-77006980 CCCTGGGGATGGGAGGTGGTGGG - Intergenic
1027443035 7:78240638-78240660 TTGTGGGGCTGGGAGGAGTTGGG + Intronic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1030905983 7:115183334-115183356 CTGAGGGGAAGGAAAGAGATAGG - Intergenic
1031923468 7:127617962-127617984 CTGTGTGGAGGAAATGAGGTGGG + Intergenic
1031929876 7:127674149-127674171 AAGTGGGGACGGAAGGAGGGAGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032343574 7:131098866-131098888 CTGTGGGGCTGGAATCTGGTAGG - Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034339309 7:150341676-150341698 AGGTGGGGGTGGGAGGAGGTGGG - Intergenic
1034926947 7:155130070-155130092 CTGCGGGGAGGGTTGGAGGTGGG + Intergenic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035287068 7:157813363-157813385 CGGTGGGGAGGGAAGAGGGTGGG + Intronic
1035373099 7:158391734-158391756 CCCTGGGGATGGGAGGAGGCAGG + Intronic
1035373206 7:158392134-158392156 CCGTGGGGAGGGAATGAGGGTGG + Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036790508 8:11715262-11715284 CTGTGGGGAGGAAAGCGGGTAGG + Intronic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037508946 8:19562115-19562137 CTGTGGGGGTGGCAGGATGGTGG - Intronic
1037631786 8:20664263-20664285 CTGTGGGCATATAAGGAGATAGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040461889 8:47657407-47657429 GTTGGGAGATGGAAGGAGGTGGG + Intronic
1040551181 8:48438846-48438868 CTGTGGACATGGAAAGAGCTGGG + Intergenic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1041040287 8:53839878-53839900 GTGTGTGGTTGGAAGGAGTTTGG - Intronic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042557326 8:70044412-70044434 GTGTGGGGAAGGTAGGGGGTGGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044269022 8:90218295-90218317 CAGTGGGGCTGAGAGGAGGTTGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047758166 8:127934448-127934470 CTCTCGGGATGGGAGGAAGTTGG + Intergenic
1047827044 8:128588117-128588139 GTGAGGGGGTGGAAGGAGGGTGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048292202 8:133189833-133189855 ATGTGTGGATGGTAGAAGGTGGG + Intergenic
1048493884 8:134919630-134919652 CTTTGCAGCTGGAAGGAGGTTGG + Intergenic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049120905 8:140736371-140736393 CAGCAGGGAGGGAAGGAGGTGGG + Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049294050 8:141820676-141820698 CTCTGGGGATCAAAGGAGGCTGG - Intergenic
1049339885 8:142106446-142106468 CTTTGGTGATGGAAGGTTGTGGG - Intergenic
1049346940 8:142144136-142144158 CTGTGGCCAGGGAAGGGGGTGGG + Intergenic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049441365 8:142611271-142611293 CTGTGGGGCTGGCAGGGTGTGGG + Exonic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1049594700 8:143477959-143477981 CTGTGGGGAGGCAGGGAGCTGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049941480 9:550196-550218 CTGGGGGGAGGGGAGGCGGTTGG - Intronic
1049963091 9:755093-755115 CTGTGGGGAAGGGTGGAGCTAGG + Intergenic
1050064193 9:1741644-1741666 TTCTGGAGAGGGAAGGAGGTAGG + Intergenic
1050816220 9:9815731-9815753 TTTAGCGGATGGAAGGAGGTAGG + Intronic
1050821519 9:9885641-9885663 ATGTGGCCATGGAAAGAGGTTGG + Intronic
1051762359 9:20481614-20481636 CTATGGGGGTGGAAGTGGGTGGG - Intronic
1052347852 9:27427998-27428020 AACTGGGGATGGAAGTAGGTTGG - Intronic
1052376135 9:27719551-27719573 CTGTGTGGAAGGAAGGTGATTGG + Intergenic
1053260962 9:36663517-36663539 GTGAGGAGATGGAAGGGGGTTGG - Intronic
1053539517 9:38959078-38959100 CGGTGGGGGTGGGAGGTGGTTGG - Intergenic
1054626624 9:67404840-67404862 CGGTGGGGGTGGGAGGTGGTTGG + Intergenic
1056533462 9:87507609-87507631 GGGAGGGGAGGGAAGGAGGTTGG + Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1056976251 9:91257453-91257475 CTGTTGGGGTGGGAGGAGGCTGG - Intronic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1058475381 9:105327707-105327729 CAGTGTGGATGAAAGGGGGTAGG - Intronic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1058968596 9:110059598-110059620 CTGTGGATGTGAAAGGAGGTGGG + Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060104024 9:120862414-120862436 CTGTGGTGGTGAAAGGAGTTGGG + Intronic
1060261018 9:122073537-122073559 AGGTGGGGAAGGAAGGAGCTGGG + Intronic
1060408128 9:123382626-123382648 CTGTTGGGAGGGAAGGAGGGCGG + Intronic
1060864866 9:126987701-126987723 CAGTGGGGATGGAACAATGTTGG - Intronic
1060972317 9:127745219-127745241 CTCTGGTGATGCAGGGAGGTGGG - Intronic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061201307 9:129140060-129140082 CTGGGGGGATGGGCGGGGGTGGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1062048382 9:134434853-134434875 CTGTGGGGCGGGGAGGGGGTCGG + Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062194846 9:135267257-135267279 TGGTGGGGAAGGAAGGTGGTAGG - Intergenic
1062363709 9:136199162-136199184 CTGTGGGGCGGGATGGGGGTGGG - Intronic
1062384913 9:136305397-136305419 CTGTAGGAATGGAAGGGGGCTGG - Intronic
1062733396 9:138121358-138121380 CTGGGGGGATGGGAGGAGAGAGG - Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188503986 X:30861355-30861377 GTGGGGGGATGGCAGGAGATGGG - Intronic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1189115303 X:38336092-38336114 TTGAGGGGTTGGAAGGAGATTGG + Intronic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1189395933 X:40622970-40622992 CTGTGGGGGTGAAAGGGCGTGGG - Intergenic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190808843 X:53864376-53864398 CTCTGGGGGTGGGAGGAGGTGGG - Intergenic
1192090120 X:68145643-68145665 CTCTGGAGAGGGAAGGATGTGGG - Intronic
1192256727 X:69467549-69467571 GTGTGGGGATCTTAGGAGGTAGG + Intergenic
1192591452 X:72363321-72363343 GGGTGGGGATGGAAGAAGGAAGG + Intronic
1193037895 X:76973290-76973312 CTGTTGAGATGGATGGAGGTTGG - Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1195217205 X:102713342-102713364 AGGTGGGGATGGAAGGTGGGGGG - Intronic
1195465717 X:105176680-105176702 CTGTGGGGAGAGAAGGGGGGTGG + Intronic
1195679155 X:107530764-107530786 TTGTTTGGGTGGAAGGAGGTAGG - Intronic
1195937450 X:110139313-110139335 CTGTGGGGATGGGTGCAGGGAGG + Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1197339072 X:125243765-125243787 CTGTAGGTGTGGAAGTAGGTGGG + Intergenic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1198847587 X:140929352-140929374 GTGTGTGGAGGGGAGGAGGTGGG + Intergenic
1198889176 X:141373879-141373901 ATGTGGGGATTGGAGGAGTTAGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199827718 X:151516295-151516317 TGGTGGGGAGGGAAGGAGGGAGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200118318 X:153778850-153778872 CTGCGGTGATGGAAGCAGGGTGG + Intronic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic