ID: 1089393082

View in Genome Browser
Species Human (GRCh38)
Location 11:118115253-118115275
Sequence AGGTGTCCACACCCCCTTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089393082_1089393091 5 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393091 11:118115281-118115303 GTGGGGCCTCCAAGAATCATGGG 0: 1
1: 0
2: 1
3: 5
4: 100
1089393082_1089393097 28 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393097 11:118115304-118115326 GAGTTCTAAGAATAGGGTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 156
1089393082_1089393095 21 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393095 11:118115297-118115319 TCATGGGGAGTTCTAAGAATAGG 0: 1
1: 0
2: 0
3: 7
4: 102
1089393082_1089393096 22 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393096 11:118115298-118115320 CATGGGGAGTTCTAAGAATAGGG 0: 1
1: 0
2: 2
3: 8
4: 146
1089393082_1089393092 6 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393092 11:118115282-118115304 TGGGGCCTCCAAGAATCATGGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1089393082_1089393090 4 Left 1089393082 11:118115253-118115275 CCCGGAAGGGGGTGTGGACACCT 0: 1
1: 0
2: 0
3: 31
4: 172
Right 1089393090 11:118115280-118115302 GGTGGGGCCTCCAAGAATCATGG 0: 1
1: 0
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089393082 Original CRISPR AGGTGTCCACACCCCCTTCC GGG (reversed) Exonic
900103262 1:971737-971759 GTGAGTGCACACCCCCTTCCCGG - Intronic
900114810 1:1023966-1023988 CGGTGGCCACAGCCCCTCCCGGG - Intronic
901008557 1:6184070-6184092 AGGTGTCAACACCAAATTCCAGG + Intronic
901663968 1:10816022-10816044 AGGTGCCCACACCCCTGTCTGGG - Intergenic
901703604 1:11058615-11058637 AGGTGCCCTCACCACCTGCCAGG + Intronic
901800714 1:11706483-11706505 CGGTGACCACAGCCCCATCCTGG - Exonic
902265619 1:15261362-15261384 TCGTGTCCACACCCCCGTTCCGG - Intronic
902482023 1:16717078-16717100 AGGGGTCCAGACCCCCATTCAGG - Intergenic
905106514 1:35566253-35566275 AGGTTTCCCCACCCCCCACCAGG - Exonic
911091643 1:94022130-94022152 AGGAGTCCAAACCCTCATCCTGG + Intronic
914924668 1:151873826-151873848 AGCTGTCCACGCCTCCCTCCTGG - Exonic
920557742 1:206916363-206916385 TGGCATTCACACCCCCTTCCTGG - Intronic
920613972 1:207470875-207470897 GGGTGTCCACACCCCCTCAGAGG - Exonic
921180367 1:212626931-212626953 AGCTTTCCTCAACCCCTTCCTGG + Intergenic
921289705 1:213646158-213646180 AGGTGTCCATAACCCTTTCAGGG - Intergenic
924416396 1:243860787-243860809 AGGTGTACACCCTCCCTTCAAGG - Intergenic
1063120362 10:3101546-3101568 AGGTGTCCACTCACCGTTCCTGG - Exonic
1066987019 10:42476384-42476406 AGGTGACCCCATCCTCTTCCCGG - Intergenic
1069157825 10:65052330-65052352 AGGTGCCCCCACCTCCCTCCCGG - Intergenic
1069687260 10:70326225-70326247 AGGTCCCCACAGCCCCTCCCAGG + Intronic
1070557454 10:77539565-77539587 AGGTGTCCCCACCAAATTCCTGG + Intronic
1075447041 10:122520163-122520185 AGGTACCCACACACCATTCCTGG - Intergenic
1077101622 11:825006-825028 AGGTTTCCACACCCCTCCCCTGG + Exonic
1078170045 11:8922912-8922934 ATGTCTCCACACCCCCTCTCGGG + Intronic
1078360871 11:10666821-10666843 AGGTGAGCAGACCCCCTTCCTGG + Intronic
1078858197 11:15223722-15223744 TGGAGTCCCCAGCCCCTTCCAGG - Intronic
1079094311 11:17501108-17501130 GGGAGTCCACACCGCCTTCCAGG + Exonic
1079129202 11:17737750-17737772 AGCTGCCCTCACCCCCTACCAGG + Intronic
1079314660 11:19397461-19397483 AGGTGTTTACAGCCCCTTTCAGG - Intronic
1080709517 11:34733728-34733750 AGGTGCCCAAACCCTCTTTCAGG + Intergenic
1083484542 11:62975155-62975177 AGCTGTACACACTGCCTTCCAGG - Intronic
1083642916 11:64155094-64155116 AGGTGCCCACACACCGTGCCAGG - Intronic
1086440257 11:86822724-86822746 AGGTGGCCCCATCCCATTCCTGG - Intronic
1086921728 11:92595262-92595284 AGGAGTCCACATCCCCATCAAGG + Intronic
1087873765 11:103331272-103331294 AGGTGTTCTTACCCCCTTACAGG + Intronic
1089393082 11:118115253-118115275 AGGTGTCCACACCCCCTTCCGGG - Exonic
1094091461 12:26654808-26654830 TGGTGGCCACACCTCCTTGCTGG - Intronic
1096621734 12:52869657-52869679 AGTTCCCCACAGCCCCTTCCAGG + Intergenic
1096778431 12:53978125-53978147 AGGTGTCCAACCCCCCTTGCAGG + Intergenic
1098161292 12:67649487-67649509 AGCTGTCCAAACCCACCTCCCGG + Intronic
1101357423 12:103993461-103993483 AGGTGGCCACCCCTCCTCCCAGG + Exonic
1103983402 12:124751265-124751287 AAGTGTCCACACCTGCTTCACGG + Intergenic
1104016060 12:124963171-124963193 AGGTGTCAGCACCCCGTTCCTGG - Intronic
1104748702 12:131224892-131224914 GTGTGACCACACCCCCTGCCTGG - Intergenic
1104784422 12:131440672-131440694 GTGTGACCACACCCCCTGCCTGG + Intergenic
1105009179 12:132744086-132744108 AGGTCTCCACACCATCTGCCTGG + Intronic
1106195973 13:27494156-27494178 AAGTGTCAACTCCCACTTCCTGG - Intergenic
1106534138 13:30624012-30624034 AGGTTCCCACTCCCCCTTCTTGG - Intronic
1107698417 13:43023193-43023215 AGCTTTCCTGACCCCCTTCCGGG - Exonic
1109597038 13:64570111-64570133 AGGTGTTGACATCTCCTTCCTGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1114932178 14:27486656-27486678 AGGTGAACCCACCCCTTTCCTGG + Intergenic
1117647263 14:57865586-57865608 CGCTGTCAACACCGCCTTCCTGG - Intronic
1120941655 14:89955784-89955806 AGGTTTCCCCAGCCCCGTCCTGG + Intronic
1121631172 14:95422861-95422883 TCCTGGCCACACCCCCTTCCTGG - Intronic
1122084306 14:99289207-99289229 AACTGTGCACACCCTCTTCCTGG - Intergenic
1122204578 14:100142206-100142228 AGGTGACCACTCTGCCTTCCTGG + Intronic
1124433858 15:29631853-29631875 GGGAGTCCACACCCCCTCCCTGG + Intergenic
1126055226 15:44723854-44723876 AGGTGTGCACCACCCATTCCTGG + Intergenic
1126833009 15:52629066-52629088 AAGTGTCCATATTCCCTTCCTGG + Intronic
1128576867 15:68782219-68782241 AGGCGTTCACACCCTCCTCCAGG - Intronic
1129685288 15:77682669-77682691 AGTTCTCCCCACCCCCTTCTGGG + Intronic
1130543901 15:84840847-84840869 AGGTGCCGACGCCCCCTGCCCGG + Exonic
1131365002 15:91831441-91831463 GGGTTCCCACACCCCCCTCCTGG - Intergenic
1131997480 15:98146140-98146162 AGGCCTCCACATCCCCTTGCTGG + Intergenic
1132615893 16:840944-840966 AGGTGTCCCCACCCCTGCCCTGG + Intergenic
1133438098 16:5797324-5797346 GTGTGTCCACACCCACTTCTTGG + Intergenic
1134304319 16:13018580-13018602 AAGTCTCCACACCCCCTGCCTGG - Intronic
1134810489 16:17163179-17163201 AGATGTCCAAGGCCCCTTCCTGG + Intronic
1135238938 16:20786157-20786179 AGGTTTGCACATCCCCTTCCAGG + Exonic
1137010291 16:35314429-35314451 GGGAGTCCACACCCCCATCCAGG - Intergenic
1138242937 16:55443759-55443781 AAGACTCCCCACCCCCTTCCTGG + Intronic
1140220095 16:73037563-73037585 AGGCCTCCACACCTCCTCCCCGG + Intronic
1140698447 16:77558805-77558827 TGATCTCCACAGCCCCTTCCAGG - Intergenic
1141265271 16:82490934-82490956 TGCTGTCCACTCCTCCTTCCAGG - Intergenic
1141894446 16:86949745-86949767 AGGTGTCCCCAACCACCTCCTGG + Intergenic
1143591159 17:7886344-7886366 GGGTGTCCACACCCCCTGCTTGG + Intronic
1147939515 17:44036371-44036393 AGGTTTCCACAGCCCCATCCTGG + Intronic
1148001416 17:44389641-44389663 GGGTGGCCTCACCCACTTCCTGG - Intergenic
1148193089 17:45693393-45693415 AGGCCTCCCCACCCACTTCCTGG - Intergenic
1150290236 17:63976998-63977020 AGTTGGCCACAGCCCCTTTCTGG + Intergenic
1152758665 17:82097583-82097605 CGGTGTTCCCACCCCCTGCCTGG - Intronic
1154306539 18:13234545-13234567 AGGAGTCCAGAGCCCCATCCAGG - Intronic
1157289634 18:46400341-46400363 AGGTGTCCAATCCCTGTTCCGGG - Intronic
1160335085 18:78031581-78031603 AGGTGTCCACAAGGCCTCCCAGG + Intergenic
1160663738 19:313258-313280 GGGTGTCTACATCCCCTTGCAGG + Intronic
1160832807 19:1111506-1111528 AGGGGTCCCCACCTTCTTCCGGG - Exonic
1161238729 19:3210345-3210367 CGGTGCCCAGGCCCCCTTCCTGG + Intergenic
1161667386 19:5585603-5585625 AGGAGGCCACACCCACCTCCAGG + Intergenic
1162094745 19:8303764-8303786 ATGTGTCCACGCCCCCAGCCTGG + Intronic
1162566572 19:11448176-11448198 AGATGTCCTCAACCCCATCCAGG - Intronic
1163584452 19:18156221-18156243 AGGGGACCACCCCCCTTTCCAGG - Intronic
1164612092 19:29639424-29639446 GGGTTCCCACAACCCCTTCCTGG + Intergenic
1165742321 19:38211479-38211501 TGGTGTCCACCCGCCCCTCCTGG - Intronic
1166010051 19:39935171-39935193 AGCTGTCCTCACTCCCTTCTTGG - Intergenic
1167355790 19:49003277-49003299 AGGTGCCCACTCCCACATCCGGG + Exonic
1167608667 19:50495530-50495552 ATGTGTCCACTCCCTCTGCCAGG + Intergenic
1167611757 19:50511147-50511169 GGGTTTCCGCATCCCCTTCCTGG + Exonic
925196012 2:1926375-1926397 GGTTGTACACACTCCCTTCCAGG + Intronic
925308853 2:2867689-2867711 GGGTGTCCAGAGCCGCTTCCAGG - Intergenic
932599980 2:73116966-73116988 GGGTGTCCTCACTGCCTTCCTGG + Intronic
933185032 2:79269148-79269170 AGGGATCCACAACTCCTTCCTGG + Intronic
936004073 2:108866378-108866400 AGATGTCCACATCCCCTTCATGG - Intronic
936153866 2:110035912-110035934 TATTGTCCACACCCCTTTCCAGG - Intergenic
936190819 2:110335503-110335525 TATTGTCCACACCCCTTTCCAGG + Intergenic
936241311 2:110790796-110790818 AGGAGTCCATACCCTCCTCCTGG + Intronic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
939500473 2:142976983-142977005 TGGTGTCCACAGCCCCTTACTGG - Intronic
942053567 2:172162757-172162779 AGGTGTCTACTCCCACTGCCTGG - Intergenic
944981880 2:205130141-205130163 TGGTGTCCTCACCCCCTGACTGG + Intronic
946386287 2:219386354-219386376 AGGTCTCCACACCGACTTGCTGG + Exonic
946600955 2:221359481-221359503 AGGTATCCACACAGACTTCCAGG - Intergenic
946619459 2:221545498-221545520 AGGTGACCACCCTCCTTTCCTGG + Intronic
947399017 2:229714243-229714265 AGGTGCACACACCCCCATTCCGG + Exonic
947915397 2:233829006-233829028 AGGACCCCACATCCCCTTCCCGG - Exonic
948667701 2:239546593-239546615 TTGTGTCCAGACCCACTTCCTGG + Intergenic
948924937 2:241089461-241089483 GAGTGTCCACACCCCCTTGGGGG + Intronic
1168851953 20:983030-983052 AGGTTTCCTCCCACCCTTCCTGG - Intronic
1169392008 20:5198168-5198190 AGGTGTTCCCACCCCCTCCCAGG + Intergenic
1176168643 20:63687382-63687404 AGGTGTCCCCAGCCTCTGCCTGG + Intronic
1176218206 20:63958034-63958056 GGGTCTCCACACCCACTCCCTGG + Exonic
1178423447 21:32460188-32460210 TGGTGTCCACACCCCCTCCAGGG + Intronic
1179980098 21:44891262-44891284 GGGCGTGCACACCCCCTGCCAGG - Intronic
1180889414 22:19275309-19275331 AGGGGGCCACACAGCCTTCCTGG + Intronic
1181307330 22:21924182-21924204 CTGTGACCACACCTCCTTCCTGG - Intronic
1182056315 22:27358103-27358125 AGGTTTCCACTCCCACATCCTGG - Intergenic
1182452255 22:30428592-30428614 AGGTGTCCACATTCCCTGGCAGG - Exonic
1183665862 22:39245288-39245310 AGGAGTCCACGCTCCCCTCCAGG + Intergenic
1184103165 22:42352221-42352243 AGGTCTCCACAGCCCCTACCTGG + Intergenic
1184635307 22:45823851-45823873 AGGTGGGCACACCCCCTGCTAGG + Intronic
1185197498 22:49481525-49481547 AGATGTGGACACACCCTTCCAGG + Intronic
950425191 3:12921287-12921309 AGGTGCACCCACCTCCTTCCAGG - Intronic
953877937 3:46676958-46676980 GGGAGTCTACAGCCCCTTCCGGG - Exonic
954689610 3:52388697-52388719 GGCTGTCCACACCCCCTCCCTGG + Intronic
955479435 3:59374501-59374523 AGGTTTCCCAACCCCCTACCTGG - Intergenic
957705098 3:83770330-83770352 GGGTGTCCGCTCCCACTTCCTGG + Intergenic
958070869 3:88609369-88609391 AGGTGTCCATACTCCCTTTTGGG + Intergenic
960511626 3:118556089-118556111 TGGTGTCCACAACCTCTTACTGG - Intergenic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
962309639 3:134315933-134315955 AGGTGTCCACAGCACAGTCCAGG - Intergenic
963776369 3:149444996-149445018 AGGTGCCCCCACCTCCCTCCCGG + Intergenic
969524587 4:7697722-7697744 CTGTGTCCACAGCCCCTGCCAGG - Intronic
970685230 4:18559579-18559601 TGGTTTCAGCACCCCCTTCCAGG - Intergenic
972369846 4:38412574-38412596 AGCTGTCCCCACCCCTGTCCTGG - Intergenic
973815707 4:54617082-54617104 AGTTGTCCTCACCCCTTTCCAGG - Intergenic
978630129 4:110734502-110734524 AGATGTCCACATCCCAATCCTGG - Intergenic
982425139 4:155249301-155249323 AGGTGACTACACCACCATCCCGG + Intergenic
983671777 4:170246304-170246326 CCCTGTCCACACCCCCTGCCTGG + Intergenic
984904163 4:184611384-184611406 GGGTTTGCACACCCCCTTGCTGG + Intergenic
985551374 5:535136-535158 AGCTGTCCACACGGCCTTGCTGG - Intergenic
986871998 5:12059546-12059568 AGGTGTCCCCACCCCTTAGCTGG - Intergenic
992886855 5:81167984-81168006 AGATCTCCACATCCCCTTGCAGG + Intronic
994630334 5:102277268-102277290 AGGTGCCCCATCCCCCTTCCAGG + Intronic
998212074 5:140207148-140207170 ATGTGTCCAGACCCACTTGCTGG - Intronic
998935592 5:147229142-147229164 AAGTGTACACTCCCCCCTCCCGG - Intergenic
999655905 5:153810651-153810673 AAGTTTCCAAACCCCTTTCCCGG + Intronic
999743223 5:154572954-154572976 AGTAGTCCACACCCCTCTCCAGG + Intergenic
1001509811 5:172312231-172312253 ATGTGTCCACACCTCTTGCCTGG - Intergenic
1002126718 5:177051092-177051114 AGCTGACCATATCCCCTTCCTGG - Intronic
1002478668 5:179484940-179484962 TGGAGTCCACACCCCCATGCCGG + Intergenic
1002570959 5:180139135-180139157 AGGTGTCCATACCCACCTGCAGG + Intronic
1003568427 6:7239922-7239944 GGGTGGCCAGTCCCCCTTCCTGG - Intronic
1005727542 6:28664552-28664574 AGGTGTCCACGACCACGTCCAGG + Intergenic
1006754768 6:36406135-36406157 ATTTGCCCACACCCCCTTCCAGG + Intronic
1011158085 6:84355998-84356020 AGGTTTCCTCACTCCCTTCCTGG + Intergenic
1017629364 6:156381420-156381442 AGATGTCTACAGCCCCTTCCTGG + Intergenic
1018845716 6:167553863-167553885 ATGTGTCCTCACGTCCTTCCCGG + Intergenic
1019145382 6:169972439-169972461 AGCTCTCCCCACCCCGTTCCCGG + Intergenic
1019406931 7:888866-888888 AGCTGCCCCCACCCCCTGCCCGG + Intronic
1019561643 7:1662251-1662273 ACATGACCACACCCACTTCCAGG - Intergenic
1019658144 7:2208974-2208996 GGGTGTCCACACCACACTCCCGG + Intronic
1019909743 7:4092587-4092609 AGGAGTCAACAACCGCTTCCCGG - Intronic
1020109302 7:5439389-5439411 AGGTGGCCACATCCCATTCCTGG - Intronic
1021995909 7:26178349-26178371 ATGTGCACACACCCCCTTCCAGG + Intronic
1024222290 7:47298254-47298276 ATGTGTCCTCAGCCCCATCCAGG - Intronic
1024461306 7:49662245-49662267 AGGTGTCCACTCCACGTTTCTGG + Intergenic
1025142734 7:56479232-56479254 AGGTGTCCACATTCCCATCCAGG - Intergenic
1025708786 7:63889832-63889854 GGGTGTCCACATTCCCATCCAGG - Intergenic
1025757272 7:64357033-64357055 TGGTGCCCACAGCCCCTTCCTGG - Intergenic
1027299059 7:76810372-76810394 AGGCCTCCACACTCCCTACCGGG - Intergenic
1029733315 7:102451782-102451804 AGATGTCCACGCCCCCTTGCCGG - Exonic
1030262580 7:107580576-107580598 AGGTGGCGACACCCGCTTCCCGG + Intronic
1032165820 7:129543901-129543923 AGGAGTCCACACCCAGCTCCCGG + Intergenic
1032390174 7:131550809-131550831 ACGTGTGCACACCCACCTCCTGG + Intronic
1033795021 7:144836096-144836118 AGGTGGCCCCGCCCGCTTCCGGG + Intronic
1035283826 7:157793974-157793996 AGGGCCCCACAGCCCCTTCCCGG + Intronic
1035568637 8:658378-658400 TTGTGTCTCCACCCCCTTCCGGG - Intronic
1036446372 8:8824842-8824864 CGCTGTGCACACCTCCTTCCTGG - Intronic
1037487417 8:19361327-19361349 AGGTCTCCATAGCACCTTCCAGG + Intronic
1041605805 8:59781136-59781158 AGGTGGCCACAACCTGTTCCTGG + Intergenic
1049344863 8:142133450-142133472 AGCTGTCCCCACCCCCACCCGGG - Intergenic
1049353609 8:142177229-142177251 AGATGTCCACATCCCTTTCCCGG + Intergenic
1058423285 9:104853891-104853913 AGATGTCCACACCCTATTCCTGG + Intronic
1060934771 9:127508573-127508595 GGGTGACCACAGCCCCTTCCTGG + Intronic
1061802204 9:133118887-133118909 AGGTGCCAACACCACCTTCTAGG - Intronic
1062041747 9:134407593-134407615 GGGTGTCCACTCCCCTCTCCTGG + Intronic
1062129845 9:134886329-134886351 TGGAGTCCAGACCTCCTTCCAGG + Intronic
1187438284 X:19292655-19292677 AGGTGTACACGCCCCATCCCTGG - Intergenic
1188222860 X:27561379-27561401 AGGGATCCTCACCCCATTCCAGG + Intergenic
1189134291 X:38532947-38532969 AGCTGTCCTCACCCCCATCTTGG + Intronic
1189856450 X:45229387-45229409 AGGTGTCCACTCCCACTGCCTGG - Intergenic
1191935499 X:66423393-66423415 AGGTGTCCATCTCCCCTTACTGG + Intergenic
1195574996 X:106439529-106439551 AGGTGGCCTCACCTCATTCCAGG - Intergenic
1195688144 X:107603566-107603588 GGGTGTCCTCACCCCTTCCCTGG + Exonic