ID: 1089395501

View in Genome Browser
Species Human (GRCh38)
Location 11:118134136-118134158
Sequence CCCCTGATGTTAGAGAGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089395501_1089395507 13 Left 1089395501 11:118134136-118134158 CCAGGCCTCTCTAACATCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1089395507 11:118134172-118134194 CCTTCTGTTCAATTACGACATGG 0: 1
1: 0
2: 0
3: 4
4: 64
1089395501_1089395508 14 Left 1089395501 11:118134136-118134158 CCAGGCCTCTCTAACATCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1089395508 11:118134173-118134195 CTTCTGTTCAATTACGACATGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1089395501_1089395509 15 Left 1089395501 11:118134136-118134158 CCAGGCCTCTCTAACATCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1089395509 11:118134174-118134196 TTCTGTTCAATTACGACATGGGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089395501 Original CRISPR CCCCTGATGTTAGAGAGGCC TGG (reversed) Exonic
900698688 1:4029460-4029482 CCCTTGATGTTAGACACTCCAGG + Intergenic
902087645 1:13875535-13875557 CCCCAGAAGTTAGAGAGGCATGG - Intergenic
903067831 1:20710705-20710727 CCCCTGCTGTGGGAGAGGCGTGG + Intronic
905099791 1:35509720-35509742 CCCCAGATGTTAGTGATCCCTGG - Intronic
905914220 1:41674013-41674035 GCCCTGGTGTCAGAGAGGCAGGG - Intronic
905978413 1:42198682-42198704 CCCCAGAGGTTAGGGTGGCCTGG - Intronic
908392360 1:63695334-63695356 TCTCTGGAGTTAGAGAGGCCAGG + Intergenic
908659563 1:66422275-66422297 CCTCTGATATTTGAGAGGGCAGG + Intergenic
913259698 1:116987065-116987087 CACCTGAGATTAGAGAGGACTGG - Exonic
913589291 1:120307716-120307738 CCATTGATGTCAGAGAAGCCTGG + Intergenic
913618894 1:120590650-120590672 CCATTGATGTCAGAGAAGCCTGG - Intergenic
914571313 1:148919584-148919606 CCATTGATGTCAGAGAAGCCTGG + Intronic
914601517 1:149210682-149210704 CCATTGATGTCAGAGAAGCCTGG - Intergenic
915083397 1:153367444-153367466 CCCCTGATGTGAGAATGGCTAGG - Intergenic
915216642 1:154344867-154344889 CCCCTGATTTCAGAGAAGACTGG + Intronic
919715188 1:200768901-200768923 CCCCTGCACTTTGAGAGGCCAGG - Intronic
920137055 1:203778442-203778464 CCCCTGAAGTTAGAGAGAAATGG + Intergenic
920971519 1:210747224-210747246 CCCCTGATGTTACTGAGCTCAGG + Intronic
921092856 1:211859713-211859735 CTCATGATGTATGAGAGGCCTGG + Intergenic
923264614 1:232302297-232302319 CCCCTGAGGCCAGAGAGACCTGG - Intergenic
923451851 1:234125498-234125520 CACCTGCTGTCAGTGAGGCCGGG + Intronic
1064139793 10:12780910-12780932 CCCCCGGTGTTGGAGAGGACAGG + Intronic
1064221072 10:13440500-13440522 CCCCTGGTTTTACAGGGGCCTGG - Intronic
1070391617 10:75975787-75975809 ACTCTGATTTTGGAGAGGCCTGG - Intronic
1071528511 10:86372262-86372284 GCCCTGGGGTCAGAGAGGCCAGG - Intergenic
1073051309 10:100669280-100669302 CCCCTGGTGGGAGAGACGCCAGG + Intergenic
1073334724 10:102697697-102697719 CTCCAAATGTTAGAGAGCCCCGG - Intronic
1079144440 11:17838198-17838220 GCCCTGTGGCTAGAGAGGCCAGG + Intronic
1079983519 11:27176844-27176866 GTCCTGATGTTAGACAGACCTGG + Intergenic
1080263381 11:30374841-30374863 TCCCAGAGGTTAGAGAGGGCTGG - Intergenic
1087368080 11:97247693-97247715 GCTCTGATGTTAGTGAGTCCTGG + Intergenic
1088355856 11:108943248-108943270 CCCCTGATGTCAGAGAAAACAGG - Intergenic
1089395501 11:118134136-118134158 CCCCTGATGTTAGAGAGGCCTGG - Exonic
1089651831 11:119919656-119919678 CCCCAGATGTGAGAGAGCCCTGG - Intergenic
1091287373 11:134415176-134415198 CTCCTGCTGAAAGAGAGGCCAGG - Intergenic
1093816745 12:23558202-23558224 CCCCTGATCTCAGAGAAGACAGG + Intronic
1093911978 12:24758770-24758792 CAGCTGAGGTGAGAGAGGCCAGG + Intergenic
1093977870 12:25442319-25442341 GCCCTGAAGTAATAGAGGCCAGG - Intronic
1095853207 12:46832177-46832199 CCCCAGATGATTGAGAGACCGGG + Intronic
1096250004 12:50025016-50025038 GCCCTGGTGTTTGAGAGGCCCGG - Intronic
1097289184 12:57899445-57899467 CACCTGATGTCACAGCGGCCGGG + Intergenic
1097522862 12:60690034-60690056 CCACTGATATTAGGGATGCCAGG + Intergenic
1100270596 12:93020845-93020867 CCCTTGAAGTTAGATAAGCCAGG - Intergenic
1100335164 12:93622418-93622440 CCAATGATGTCAGAGAGGACAGG - Intergenic
1102045532 12:109828006-109828028 CCCCTGAGGGTGGAGTGGCCTGG - Intronic
1102442682 12:112975502-112975524 ACCCTGGAGTAAGAGAGGCCAGG + Intergenic
1104192797 12:126499442-126499464 ACCATGATGCAAGAGAGGCCAGG + Intergenic
1105900141 13:24746282-24746304 CGGCTGAGATTAGAGAGGCCTGG + Intergenic
1106317636 13:28609078-28609100 GTGCTGATGTTAGAGAGCCCTGG + Intergenic
1112595315 13:100802488-100802510 CCCCAGAACTTTGAGAGGCCAGG + Intergenic
1112743690 13:102503813-102503835 CCCCTAAAGTTAAAGATGCCAGG + Intergenic
1123019502 14:105391087-105391109 CCCATGATGCTGGAGCGGCCAGG - Intronic
1123707903 15:22963823-22963845 CCCCAGTTGTGAGAGATGCCTGG + Intronic
1124214357 15:27794190-27794212 CCCCTCATCTTTGAGAGGCGTGG + Intronic
1125785388 15:42312297-42312319 CCCCTGTTGTGGGAGAGACCCGG + Intronic
1125975958 15:43951882-43951904 CCCAAGATGTAAGAGAGGCCTGG - Intronic
1129245234 15:74275136-74275158 CCCAAGATGTCAGAGAGGGCAGG - Intronic
1129263439 15:74381695-74381717 CTCCTGTGGTGAGAGAGGCCTGG - Intergenic
1129666040 15:77579889-77579911 ACCCTGAGGTTAGAGAGGAGAGG - Intergenic
1129690409 15:77710118-77710140 CCCCTGGGGTTCCAGAGGCCTGG - Intronic
1130923393 15:88367342-88367364 CACCTGCTGTAAGAGAGGCATGG - Intergenic
1139437968 16:66947848-66947870 CCCCTGCTGCAACAGAGGCCTGG + Intergenic
1140050000 16:71472136-71472158 GCCCTTATGAGAGAGAGGCCAGG + Intronic
1140880707 16:79195585-79195607 ACCCTGAAGTTAGAGAGGCATGG - Intronic
1141517298 16:84554115-84554137 CCCCGGATGTCAGAGAGTCTGGG + Intergenic
1142717697 17:1755897-1755919 CCCTGGAAGTCAGAGAGGCCTGG + Intergenic
1143917048 17:10301811-10301833 TCCCTGATGGCAGAGAGGGCAGG + Intronic
1145106655 17:20123509-20123531 CTCCTCATGTCAGAGAGGACAGG - Intronic
1148772097 17:50073298-50073320 CCCCTGCTGTGAGACAGCCCTGG + Intronic
1149074192 17:52577583-52577605 TCCTTGATTTTAGAGTGGCCTGG - Intergenic
1151439436 17:74118698-74118720 CGCCTGATGATGGAGAAGCCAGG - Intergenic
1152960943 18:79868-79890 CCCCTCTTCTCAGAGAGGCCAGG + Intergenic
1153577408 18:6536446-6536468 GTCCTGGTGTCAGAGAGGCCAGG - Intronic
1156363418 18:36404135-36404157 CCCAGGAGGTCAGAGAGGCCTGG - Intronic
1158559444 18:58501543-58501565 CTCCTGATGTTAGAGGGCTCTGG - Intronic
1159071051 18:63624522-63624544 CCCCTTGTGTCAGTGAGGCCTGG - Intergenic
1159849123 18:73505352-73505374 GCCCTGAAGTTAGAGAGCCCTGG + Intergenic
1161062451 19:2222025-2222047 CTCCAGGTGTGAGAGAGGCCGGG - Exonic
1162261550 19:9538505-9538527 GCCCGGACGTTAGAGAGGCCTGG - Intronic
1162435483 19:10655153-10655175 ACCCTGATCTGAGAGAGGCCTGG - Intronic
1163789500 19:19298200-19298222 CCCTTTGTGTTACAGAGGCCGGG + Intronic
1164761467 19:30731601-30731623 TCCCAGATGCTGGAGAGGCCAGG + Intergenic
1164785183 19:30924950-30924972 ACCCAGATATTACAGAGGCCTGG + Intergenic
1167300774 19:48676286-48676308 CCCCCGATGTTTAAGAGGACAGG + Intergenic
1167637291 19:50662341-50662363 CCACGGATGTCAAAGAGGCCTGG + Exonic
1168225715 19:54993591-54993613 CCCAGCATGTTAGGGAGGCCAGG + Intronic
1168549978 19:57284689-57284711 CCCCTGATTTTGGAGAGGAGAGG - Intronic
927357683 2:22192046-22192068 CACATGTTGTGAGAGAGGCCTGG + Intergenic
929387589 2:41428297-41428319 CCCCTGAAGTTAGGAAGGCTTGG - Intergenic
929818999 2:45258522-45258544 CCTGTGAAGTTAGTGAGGCCTGG - Intergenic
932819068 2:74884344-74884366 CCCCTGGGGTTAGAGACCCCAGG + Intronic
940402311 2:153261934-153261956 CCCCTGATGTAAGAGACTCAGGG - Intergenic
942501136 2:176592147-176592169 CCCCAGATGTGAGGGAGACCTGG + Intergenic
945406892 2:209459641-209459663 CCTCAGATGTAAGAGAGTCCAGG - Intronic
946228941 2:218279853-218279875 ACCCTGGGGTTAGAGAAGCCAGG + Intronic
946378208 2:219327085-219327107 CCCCTCATGCCAGACAGGCCTGG - Intergenic
946434012 2:219640306-219640328 CCCGTGAGGATGGAGAGGCCTGG - Intronic
948822736 2:240558096-240558118 CCCCTGAAGTCACAGAGGGCGGG - Intronic
948982202 2:241500108-241500130 CCACTGACCTTAGAGAGGCCGGG - Intronic
1173936440 20:46870213-46870235 CCCCTGAGGTAGGAGAGGCAGGG + Intergenic
1174417480 20:50377044-50377066 CACCTGATGTCAGCAAGGCCTGG + Intergenic
1175735875 20:61386575-61386597 ACCATGAGGTTAGAGAGGCTGGG + Intronic
1175766896 20:61598347-61598369 CCCCTGAGGTGACAGTGGCCGGG - Intronic
1175886526 20:62294662-62294684 GCCCTGTTGTCAGTGAGGCCTGG + Exonic
1177742911 21:25175391-25175413 CCAGTGATGTCAGAGAGGCTGGG + Intergenic
1179607448 21:42526409-42526431 CCCCTGATGGTCTACAGGCCGGG - Intronic
1181368278 22:22396945-22396967 CCCCTCAATTAAGAGAGGCCAGG + Intergenic
1183726881 22:39594781-39594803 CCCCGGATGTTGGAGTGGGCAGG + Intronic
1185116555 22:48941380-48941402 CCTCAGATGTGGGAGAGGCCTGG + Intergenic
950614430 3:14147782-14147804 GCCATGATGTCAGAGAGGGCTGG + Intronic
953504730 3:43473864-43473886 CCCCTGAAGATGGAGAGGTCTGG + Intronic
954469249 3:50677671-50677693 GCCCTGATGTTAGTGAGGGAAGG + Intronic
955245488 3:57220966-57220988 CCCCTAATGTAAGAGTGGCCTGG - Intronic
958869057 3:99535433-99535455 TCCTTGTTGTTAAAGAGGCCAGG - Intergenic
961179206 3:124863064-124863086 ACACTGATGATAGAGATGCCTGG - Intronic
962311632 3:134331083-134331105 CCCCTGACCTCAGTGAGGCCAGG - Intergenic
962480815 3:135796648-135796670 TTCCTGATGTCAGAGATGCCTGG + Intergenic
962837585 3:139202836-139202858 TCCCTGAGGTTAGCTAGGCCAGG + Intronic
963462349 3:145632856-145632878 CCTATTATGTTAGAGGGGCCAGG + Intergenic
967874550 3:194258180-194258202 CTCCTGATGTTGGAGGGCCCTGG + Intergenic
969357763 4:6640607-6640629 CCCCTGACCGTAAAGAGGCCCGG + Exonic
972041340 4:34604020-34604042 CCACAGCTGTTAGAGAGGTCAGG - Intergenic
973817234 4:54630390-54630412 GCCCTGATCTTGGAGAGGCAGGG + Intergenic
985052145 4:186001564-186001586 CTCCTACTGTTAGAGAGGCTTGG + Intergenic
987134435 5:14887712-14887734 CCTCTGACGTTAGAGAGCCTGGG - Intergenic
987747494 5:21995056-21995078 CACCTGAAGTTAGTGAGACCAGG + Intronic
990400280 5:55430293-55430315 GCACTGATGTTAGAGGGTCCAGG - Intronic
991956287 5:71998610-71998632 GCCCTGAAGTCATAGAGGCCAGG + Intergenic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
992451341 5:76879030-76879052 CACCGGCTGTTAGAGAGGCTAGG - Intronic
993413075 5:87595828-87595850 CACCTGTTGTGGGAGAGGCCTGG - Intergenic
996973402 5:129400388-129400410 CTTCTGATGTTAGAGTTGCCTGG + Intergenic
997400675 5:133599371-133599393 CCCCTGAGGTTAGGGAGGCGGGG + Intronic
999279194 5:150353832-150353854 CCCCTGAGATCAGAGAGGGCTGG - Intergenic
1001652286 5:173324385-173324407 CCTCTGTTTTTAGACAGGCCCGG + Intronic
1003087809 6:3075172-3075194 CCAGTGATGTTTGAGAGGTCTGG + Intronic
1003505543 6:6737315-6737337 CCCCTGTTGCAACAGAGGCCCGG - Intergenic
1004627985 6:17394110-17394132 CCCCCAAAGTTAGAGCGGCCGGG - Intronic
1006467696 6:34205983-34206005 CCCCTGCTGTTAGGCAGGCAAGG - Intergenic
1007382092 6:41496877-41496899 CCCCTGATGTTAAGGATACCTGG - Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1008276423 6:49549529-49549551 CCCCTGTGGTTAAAGAGGACGGG + Intergenic
1008288876 6:49687888-49687910 CCCCTGATGCAGCAGAGGCCTGG + Intergenic
1008425371 6:51350116-51350138 GCCCTGATTGGAGAGAGGCCTGG - Intergenic
1015188240 6:130443680-130443702 CCCCTGATGTGACAGATGACTGG + Intergenic
1016993459 6:149944995-149945017 CCTCTCTTGCTAGAGAGGCCTGG + Intronic
1017004874 6:150022535-150022557 CCTCTCTTGCTAGAGAGGCCTGG - Intronic
1019306029 7:336137-336159 CCCATGATGGTAGAGGGGCCTGG - Intergenic
1019306113 7:336395-336417 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306155 7:336509-336531 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306174 7:336566-336588 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306195 7:336624-336646 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306214 7:336681-336703 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306235 7:336739-336761 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306278 7:336855-336877 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306297 7:336912-336934 CCCGTGGTGGTGGAGAGGCCCGG - Intergenic
1019306328 7:336999-337021 TCCATGATGGTGGAGAGGCCTGG - Intergenic
1022461174 7:30608767-30608789 CCCCTGTTCTTAGAGAGGTTAGG + Intronic
1023851769 7:44154085-44154107 GCACTGATGTGAGAGACGCCTGG + Intronic
1027624274 7:80528253-80528275 GACCTGATGCTAGGGAGGCCTGG - Intronic
1031490649 7:122383682-122383704 CACCTGATTGTAGAGAGGCCAGG - Intronic
1032963519 7:137068764-137068786 CACATGATGTAAGAGAGGGCAGG - Intergenic
1033446216 7:141424497-141424519 GCTCTGATGGAAGAGAGGCCTGG - Intronic
1035743977 8:1948205-1948227 CCCAGGATGTTGGAGGGGCCCGG - Intronic
1043008310 8:74848609-74848631 CGCCTGATGATACAGAGCCCTGG - Intronic
1043937443 8:86157580-86157602 CTCCTTATGTAAGGGAGGCCAGG + Intergenic
1044265192 8:90173723-90173745 ACCCTGATGGGACAGAGGCCAGG + Intergenic
1045305920 8:100956626-100956648 CTCCTGAAGCTAGCGAGGCCAGG - Intergenic
1046950807 8:120018127-120018149 CCCCTGAACCAAGAGAGGCCAGG + Intronic
1047199565 8:122753729-122753751 CCCCTGGTGTTGGAGAAGCAAGG + Intergenic
1047413835 8:124647828-124647850 CCTCTGATTTTAGAGAGTTCTGG - Intronic
1047594582 8:126365574-126365596 TCCCTGATATTAAAGAGGACAGG + Intergenic
1048832739 8:138492473-138492495 CCCCAGCTGTGATAGAGGCCAGG - Intronic
1050635548 9:7608554-7608576 CTCCTGATCTTAGAGAAGACTGG + Intergenic
1050674455 9:8036507-8036529 CCCCTGTTGTCAGTGTGGCCTGG - Intergenic
1057260118 9:93578201-93578223 TCCCTGCTGTTAGAAGGGCCTGG + Intronic
1057702636 9:97374919-97374941 CCCATGATGAAAGGGAGGCCTGG + Intronic
1059134862 9:111795245-111795267 CCCATGTTGTTAGCGAGGCCGGG + Intergenic
1059229905 9:112710376-112710398 AGCCTGATTTTAGAGAGACCTGG - Intronic
1060862313 9:126964605-126964627 CCTCTGAGGTCAGATAGGCCTGG - Intronic
1062193774 9:135262282-135262304 CTCATGATGTTAGAGGGACCTGG - Intergenic
1062737221 9:138144121-138144143 CCCCTCTTCTCAGAGAGGCCGGG - Intergenic
1185985198 X:4824921-4824943 CCCTTGTTGTGGGAGAGGCCTGG + Intergenic
1189556810 X:42153560-42153582 CCCCTGAGGTTTGAGTGGGCAGG - Intergenic
1192308532 X:69988924-69988946 CCCCTGGTGCTAGGGAGGCCCGG + Intronic
1195793584 X:108618794-108618816 CACCTGATGTTCAAGAGGCAGGG - Intronic
1198282781 X:135158239-135158261 GCCTTGATGTTTGAGATGCCTGG + Exonic
1200066890 X:153508228-153508250 CACCTGAAGGCAGAGAGGCCGGG - Exonic