ID: 1089396745

View in Genome Browser
Species Human (GRCh38)
Location 11:118141096-118141118
Sequence GAATGGGAATGGGGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2038
Summary {0: 1, 1: 0, 2: 12, 3: 144, 4: 1881}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089396745 Original CRISPR GAATGGGAATGGGGGGAAGG AGG Intronic
Too many off-targets to display for this crispr