ID: 1089398877

View in Genome Browser
Species Human (GRCh38)
Location 11:118153072-118153094
Sequence GCCTCGCGGTCCCGGAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089398866_1089398877 6 Left 1089398866 11:118153043-118153065 CCCGCTGCGCACCCTGCCTGCCG No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398862_1089398877 12 Left 1089398862 11:118153037-118153059 CCCCCGCCCGCTGCGCACCCTGC No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398867_1089398877 5 Left 1089398867 11:118153044-118153066 CCGCTGCGCACCCTGCCTGCCGC No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398865_1089398877 9 Left 1089398865 11:118153040-118153062 CCGCCCGCTGCGCACCCTGCCTG No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398861_1089398877 20 Left 1089398861 11:118153029-118153051 CCGGGGAGCCCCCGCCCGCTGCG No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398863_1089398877 11 Left 1089398863 11:118153038-118153060 CCCCGCCCGCTGCGCACCCTGCC No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398868_1089398877 -5 Left 1089398868 11:118153054-118153076 CCCTGCCTGCCGCACCCCGCCTC No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398869_1089398877 -6 Left 1089398869 11:118153055-118153077 CCTGCCTGCCGCACCCCGCCTCG No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398864_1089398877 10 Left 1089398864 11:118153039-118153061 CCCGCCCGCTGCGCACCCTGCCT No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398871_1089398877 -10 Left 1089398871 11:118153059-118153081 CCTGCCGCACCCCGCCTCGCGGT No data
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data
1089398860_1089398877 29 Left 1089398860 11:118153020-118153042 CCGCGTAGGCCGGGGAGCCCCCG 0: 1
1: 1
2: 2
3: 6
4: 103
Right 1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089398877 Original CRISPR GCCTCGCGGTCCCGGAGCCC CGG Intergenic
No off target data available for this crispr