ID: 1089400025

View in Genome Browser
Species Human (GRCh38)
Location 11:118159053-118159075
Sequence ACAGGGGTATAGAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089400012_1089400025 22 Left 1089400012 11:118159008-118159030 CCCCACCACTGATAGATCAGATA No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400014_1089400025 20 Left 1089400014 11:118159010-118159032 CCACCACTGATAGATCAGATACA No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400013_1089400025 21 Left 1089400013 11:118159009-118159031 CCCACCACTGATAGATCAGATAC No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400011_1089400025 28 Left 1089400011 11:118159002-118159024 CCACGTCCCCACCACTGATAGAT No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400010_1089400025 29 Left 1089400010 11:118159001-118159023 CCCACGTCCCCACCACTGATAGA No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400021_1089400025 -9 Left 1089400021 11:118159039-118159061 CCAGGTAAAGCGGTACAGGGGTA No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400015_1089400025 17 Left 1089400015 11:118159013-118159035 CCACTGATAGATCAGATACAGAA No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data
1089400009_1089400025 30 Left 1089400009 11:118159000-118159022 CCCCACGTCCCCACCACTGATAG No data
Right 1089400025 11:118159053-118159075 ACAGGGGTATAGAGGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089400025 Original CRISPR ACAGGGGTATAGAGGGGACC TGG Intergenic
No off target data available for this crispr