ID: 1089401081

View in Genome Browser
Species Human (GRCh38)
Location 11:118165083-118165105
Sequence GAGGAGGAGTGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2245
Summary {0: 1, 1: 0, 2: 15, 3: 197, 4: 2032}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089401081_1089401098 11 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401098 11:118165117-118165139 GAGGGGCTGGGCTCCTGGGAGGG 0: 1
1: 0
2: 5
3: 66
4: 755
1089401081_1089401094 6 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401094 11:118165112-118165134 GGCCAGAGGGGCTGGGCTCCTGG 0: 1
1: 0
2: 8
3: 115
4: 834
1089401081_1089401089 -6 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401089 11:118165100-118165122 CTCCTCAGTCCTGGCCAGAGGGG 0: 1
1: 0
2: 13
3: 204
4: 651
1089401081_1089401101 17 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401101 11:118165123-118165145 CTGGGCTCCTGGGAGGGGGCAGG 0: 1
1: 0
2: 15
3: 127
4: 1135
1089401081_1089401100 13 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401100 11:118165119-118165141 GGGGCTGGGCTCCTGGGAGGGGG 0: 1
1: 1
2: 15
3: 142
4: 1084
1089401081_1089401097 10 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401097 11:118165116-118165138 AGAGGGGCTGGGCTCCTGGGAGG 0: 1
1: 0
2: 2
3: 71
4: 567
1089401081_1089401086 -8 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401086 11:118165098-118165120 TCCTCCTCAGTCCTGGCCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 320
1089401081_1089401095 7 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401095 11:118165113-118165135 GCCAGAGGGGCTGGGCTCCTGGG 0: 1
1: 0
2: 5
3: 58
4: 538
1089401081_1089401088 -7 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401088 11:118165099-118165121 CCTCCTCAGTCCTGGCCAGAGGG 0: 1
1: 1
2: 4
3: 41
4: 300
1089401081_1089401099 12 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401099 11:118165118-118165140 AGGGGCTGGGCTCCTGGGAGGGG 0: 1
1: 0
2: 9
3: 109
4: 920
1089401081_1089401102 18 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401102 11:118165124-118165146 TGGGCTCCTGGGAGGGGGCAGGG 0: 1
1: 0
2: 8
3: 103
4: 2180
1089401081_1089401091 -2 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401091 11:118165104-118165126 TCAGTCCTGGCCAGAGGGGCTGG 0: 1
1: 1
2: 5
3: 45
4: 392
1089401081_1089401092 -1 Left 1089401081 11:118165083-118165105 CCTGCTTCCCTCCACTCCTCCTC 0: 1
1: 0
2: 15
3: 197
4: 2032
Right 1089401092 11:118165105-118165127 CAGTCCTGGCCAGAGGGGCTGGG 0: 1
1: 0
2: 4
3: 51
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089401081 Original CRISPR GAGGAGGAGTGGAGGGAAGC AGG (reversed) Exonic
Too many off-targets to display for this crispr