ID: 1089401760

View in Genome Browser
Species Human (GRCh38)
Location 11:118168489-118168511
Sequence CCGGCCCCGGCACTGCGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089401760_1089401772 6 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401772 11:118168518-118168540 GACCAGGGGCTTCATGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 118
1089401760_1089401773 7 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401773 11:118168519-118168541 ACCAGGGGCTTCATGCCATGGGG 0: 1
1: 0
2: 0
3: 26
4: 156
1089401760_1089401769 -8 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401769 11:118168504-118168526 GGGGCCGGTGGTGGGACCAGGGG 0: 1
1: 0
2: 1
3: 39
4: 735
1089401760_1089401771 5 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401771 11:118168517-118168539 GGACCAGGGGCTTCATGCCATGG 0: 1
1: 0
2: 1
3: 19
4: 167
1089401760_1089401768 -9 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401768 11:118168503-118168525 CGGGGCCGGTGGTGGGACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 305
1089401760_1089401767 -10 Left 1089401760 11:118168489-118168511 CCCTAGCGCAGTGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1089401767 11:118168502-118168524 CCGGGGCCGGTGGTGGGACCAGG 0: 1
1: 0
2: 3
3: 50
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089401760 Original CRISPR CCGGCCCCGGCACTGCGCTA GGG (reversed) Intronic
900087499 1:905339-905361 CCCGCCCCGACAATGCGCGAGGG - Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900967186 1:5966892-5966914 CCGACCCCTGCTCTGCTCTAAGG + Intronic
901789460 1:11646767-11646789 CCGGAGCCTGCACTGGGCTATGG - Intergenic
904006643 1:27366511-27366533 CCGGCCCCGGCTCAGCGCCACGG + Exonic
905212744 1:36385757-36385779 GCAGCCCCGGCTCTGGGCTACGG - Exonic
913016641 1:114743434-114743456 CCGGCCCCTGCACTGCGCCCTGG + Intronic
914386160 1:147172227-147172249 CCGGCCCCGCCCCTGCGCCTCGG + Intronic
924495656 1:244586067-244586089 CCGGCTCCGTCTCTGCACTAAGG + Intronic
1066436432 10:35400255-35400277 CCGCCCCCTGCACTGTGCTAGGG - Intronic
1068939005 10:62662612-62662634 CAGGCCCAGGCACTGCTCCATGG + Intronic
1070819834 10:79348171-79348193 CCGGCCCCGCCCCTGCGGTCGGG + Intronic
1072656522 10:97334143-97334165 ACGGCCCCGGCAGCGCGCTGGGG + Exonic
1076354229 10:129840472-129840494 GCGGCCGCGGCACAGCGCCACGG + Intronic
1076395875 10:130136861-130136883 CCCGCCCCGCCACTGCGGCACGG - Intronic
1076861717 10:133141052-133141074 ACTGCCCCTGCACGGCGCTAAGG - Intergenic
1078801169 11:14644717-14644739 GCGGCTCCGGCACTGCGTTCTGG + Exonic
1081749766 11:45501677-45501699 CCGGCCCCAGCTCTGCCCGATGG + Intergenic
1085333058 11:75668748-75668770 CCGGCCCCTCCTCTGCGCCATGG - Exonic
1085456188 11:76666561-76666583 GCTGCCCCGGCACTGCTCTGCGG + Intronic
1089401760 11:118168489-118168511 CCGGCCCCGGCACTGCGCTAGGG - Intronic
1089692897 11:120197811-120197833 CTGGCCCCGGCTCTGAACTAGGG + Intergenic
1090699376 11:129279872-129279894 TCGGCCCCGGCATTGTGCTGCGG + Intergenic
1092030067 12:5276519-5276541 CGGGCCCTGGCACTGCCCTGGGG + Intergenic
1098385789 12:69917125-69917147 AAGGCCTCGGCACTGCTCTAAGG - Intronic
1106841817 13:33692110-33692132 CCAGCCCCGGCAACCCGCTAGGG - Intergenic
1112196816 13:97234483-97234505 CCCGCCCCCGCACTGTGCTCAGG - Intronic
1113769241 13:112897991-112898013 CCGGCCCCGGCCCTGGGTCATGG + Intronic
1114535149 14:23417885-23417907 CTGGCCCAGCCTCTGCGCTATGG + Intronic
1115120059 14:29927860-29927882 CCGGCCCCCGCCCGGCGCTCGGG - Intronic
1126581482 15:50246186-50246208 CCACCCCAGGCACTGTGCTAAGG + Intronic
1129601223 15:76999716-76999738 CCAGCCCCGGCACTGAACTATGG - Intronic
1132980680 16:2737411-2737433 TCGGGCCCTGCACTGCCCTAGGG + Intergenic
1134027826 16:10967937-10967959 TGGGCCCCGGCCCTGCGCCACGG - Intronic
1137540322 16:49357227-49357249 CCGGCCCCGGCAGGGGGCTTTGG - Intergenic
1139566564 16:67781122-67781144 CAGCCTCCGGCACTGCGCTCAGG - Intronic
1141693978 16:85611496-85611518 CCGGCCCTGGCACGGCGCGGGGG - Intronic
1142346530 16:89557587-89557609 CAGGCCCAGGCACTGGGCTCCGG + Exonic
1142581902 17:948530-948552 CAGGGCCCGGCCCTGCGCTGGGG + Intronic
1143106139 17:4531455-4531477 CCAGCCCTGGCGCTGTGCTAGGG + Intronic
1144021273 17:11241412-11241434 CCGGCCCCGCCATGGCGCTGCGG + Exonic
1145937867 17:28725843-28725865 CCGGCCCCGGCTCCCCGCTCAGG + Intronic
1147168719 17:38606117-38606139 CCGGCCCCGGCCGCGCGCTGCGG - Intergenic
1148050468 17:44767665-44767687 GCTGCCCCGGCACTGCCCCAGGG + Intronic
1150654592 17:67031608-67031630 CTGGCCCCGGGACAGCGCAAAGG - Exonic
1153238689 18:3012635-3012657 CCGCCCCCGGCCCTGCGGGAGGG - Intronic
1153688604 18:7568608-7568630 CTGGCCGCGGCGCTCCGCTAGGG - Intronic
1158962628 18:62598924-62598946 CGTGCGCCGACACTGCGCTAGGG - Intergenic
1161454666 19:4363987-4364009 CCAGCCTCGGCACTGCCCTCTGG - Intronic
1161576671 19:5058344-5058366 CCGGGCCTGGCACTGCTCTGGGG - Intronic
1161682564 19:5687386-5687408 CCGGCCCCGGCTCTGCGGGACGG + Intronic
1167134882 19:47610057-47610079 CCGGCCGGGGCACCGCGCTCGGG + Intronic
929788096 2:45006271-45006293 CCGGCACTGGCACTGCGCTGGGG + Exonic
930096456 2:47570335-47570357 CCGGCCCCGGGGCTGAGCTCCGG - Exonic
936389011 2:112055209-112055231 CCGGCCCCGCCTCCGCGCTCGGG + Exonic
938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG + Intronic
940009531 2:149038973-149038995 CCGACCCCGCCACTGCGCCGCGG - Intronic
940215038 2:151295924-151295946 TTGGCCCCGCCACTGCACTATGG + Intergenic
1169207821 20:3749899-3749921 CCGGCCCCGCCACTGCCCCCTGG + Intronic
1170969070 20:21101828-21101850 CTGGCCCCTGCACTCAGCTAGGG - Intergenic
1171427627 20:25058356-25058378 CTGGCCCAGGCGCTGCGCTCCGG + Intronic
1172961729 20:38805233-38805255 CCGGCCCTGGCCTTGCGCTGGGG - Intergenic
1174586211 20:51610258-51610280 CCCGCGCCGGCACTGCTGTAAGG + Intronic
1175895246 20:62333140-62333162 CCTGCCCCGGCCCTGCCCCACGG - Exonic
1179189831 21:39114395-39114417 CCGGGCCAGGCACTGCACTGGGG + Intergenic
1184680627 22:46070816-46070838 GCGGCCCCGGGACAGCGCTCGGG - Intronic
1185037997 22:48489722-48489744 CCGGCCCCGGCACGGCCCTCTGG + Intronic
962935512 3:140076947-140076969 CCCGCCCAGGCACTGTGCTTTGG + Intronic
993504656 5:88694341-88694363 CGCGCCCCGGCTCTGCGCTGGGG + Intergenic
997665099 5:135624214-135624236 CCCACCCCATCACTGCGCTATGG - Intergenic
1019299418 7:295943-295965 CCGGCCCCCGCCCTGCCCCAGGG + Intergenic
1020445412 7:8262270-8262292 CCGGCCGCTGCGCTGCGCTGCGG - Exonic
1022667689 7:32427562-32427584 CCGGCCCCGGTACTAAGCTGGGG + Intergenic
1023417777 7:39949338-39949360 CCGGAACCGGCACTGCGCGCTGG + Intergenic
1024156997 7:46636223-46636245 CTGGCCCCAGCAGTGGGCTATGG - Intergenic
1024231367 7:47366453-47366475 CCGGGCCAGGCACTGGGATAGGG + Intronic
1028641138 7:93043497-93043519 CCGGCTCCGGCGCTGGGCTGCGG - Intergenic
1032074708 7:128830984-128831006 TCGCCCCCGGCACTGACCTATGG - Exonic
1035361887 7:158318683-158318705 CCGGCACCGTCACTGCTCTGGGG - Intronic
1037810045 8:22081603-22081625 CAGTCCCCGGCAGTGAGCTATGG + Exonic
1043502805 8:80873839-80873861 CCGGTCCCGGCGCTGCGCGGCGG + Intronic
1049473891 8:142788104-142788126 CAGGCCCCGGCACTGTGTCAGGG - Intergenic
1059769855 9:117414888-117414910 CCGGCCCCGGCTCGGGGCTCCGG - Exonic
1060740168 9:126092585-126092607 CCAGCCCCAGCACTGCTCTGTGG - Intergenic
1060880142 9:127112336-127112358 CCGCCCCCGACCCTGGGCTAGGG + Intronic
1062026660 9:134343750-134343772 CCGGGCGCGGCACTGAGCTGAGG + Intronic
1062233375 9:135495797-135495819 CTGCCCCCGGCACTGTTCTAAGG + Intronic
1062262866 9:135671567-135671589 CTGGCCCTGGCACTGCGCTGTGG - Intergenic
1062397134 9:136357042-136357064 CCGGCCCTGGCTCTGCCCTCTGG - Intronic
1186426011 X:9464948-9464970 CCGGCCCCGCCCCTGCGCCCCGG - Intronic
1189531123 X:41884120-41884142 CAGGCCCTGGCTCTGCTCTAGGG - Intronic
1190385643 X:49879968-49879990 CCGGCCCCGGCGCGGCCCTGGGG + Exonic
1196738807 X:119006338-119006360 CCAGCCACGGCACTGTGGTAGGG + Intronic