ID: 1089403838

View in Genome Browser
Species Human (GRCh38)
Location 11:118181273-118181295
Sequence TGTAAGGTAAATAACTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089403838_1089403851 29 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403851 11:118181325-118181347 CCAGCATCATGGGTGTCACCTGG No data
1089403838_1089403842 -2 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403842 11:118181294-118181316 CAGCCTCACTTTTCAAAGTGTGG No data
1089403838_1089403844 6 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403844 11:118181302-118181324 CTTTTCAAAGTGTGGTCCCCAGG No data
1089403838_1089403852 30 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403852 11:118181326-118181348 CAGCATCATGGGTGTCACCTGGG No data
1089403838_1089403845 18 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403845 11:118181314-118181336 TGGTCCCCAGGCCAGCATCATGG No data
1089403838_1089403846 19 Left 1089403838 11:118181273-118181295 CCTCCCTAGTTATTTACCTTACA No data
Right 1089403846 11:118181315-118181337 GGTCCCCAGGCCAGCATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089403838 Original CRISPR TGTAAGGTAAATAACTAGGG AGG (reversed) Intergenic
No off target data available for this crispr