ID: 1089407350

View in Genome Browser
Species Human (GRCh38)
Location 11:118209286-118209308
Sequence GGTAAGATTTGGTCTGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089407350_1089407359 21 Left 1089407350 11:118209286-118209308 CCTTATTCAGACCAAATCTTACC 0: 1
1: 0
2: 3
3: 9
4: 124
Right 1089407359 11:118209330-118209352 AGGAAAAAGGAAAAGGACTTTGG 0: 1
1: 1
2: 15
3: 123
4: 1095
1089407350_1089407354 1 Left 1089407350 11:118209286-118209308 CCTTATTCAGACCAAATCTTACC 0: 1
1: 0
2: 3
3: 9
4: 124
Right 1089407354 11:118209310-118209332 GGCAGCCCAATGAATACAACAGG 0: 1
1: 0
2: 1
3: 20
4: 91
1089407350_1089407358 14 Left 1089407350 11:118209286-118209308 CCTTATTCAGACCAAATCTTACC 0: 1
1: 0
2: 3
3: 9
4: 124
Right 1089407358 11:118209323-118209345 ATACAACAGGAAAAAGGAAAAGG 0: 1
1: 1
2: 5
3: 137
4: 1205
1089407350_1089407357 8 Left 1089407350 11:118209286-118209308 CCTTATTCAGACCAAATCTTACC 0: 1
1: 0
2: 3
3: 9
4: 124
Right 1089407357 11:118209317-118209339 CAATGAATACAACAGGAAAAAGG 0: 1
1: 0
2: 2
3: 50
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089407350 Original CRISPR GGTAAGATTTGGTCTGAATA AGG (reversed) Intronic
901946581 1:12709012-12709034 GGGAAAATTTGGACTGAATGAGG - Intergenic
903792098 1:25900614-25900636 GGTAAGATTGGGACAGAATTGGG + Intronic
906456195 1:45999224-45999246 GATAAAATTTGTTTTGAATAAGG - Intronic
906971607 1:50520537-50520559 GGTAAGATTTGATCTGGTTCTGG - Intronic
907089982 1:51714554-51714576 GGTTAGATGTGGTTTGAATTAGG + Intronic
907215603 1:52861080-52861102 GTTAAAATTTGGTCTAAGTAAGG + Intronic
909136803 1:71811411-71811433 GGTGACATTGGATCTGAATAAGG - Intronic
909193387 1:72584393-72584415 GATAATATTTGGAATGAATATGG + Intergenic
910871349 1:91835883-91835905 GGGAAGATTTGGTATTCATAGGG - Intronic
911546167 1:99219688-99219710 AGCAAGATTTGGTAAGAATATGG - Intergenic
916380581 1:164206442-164206464 TGTAAGATCCAGTCTGAATAAGG - Intergenic
919435994 1:197561869-197561891 GATGAGATTTGGTCAGAATATGG - Intronic
922764877 1:228151479-228151501 GGTGAGGTTGAGTCTGAATAGGG + Intronic
1064536590 10:16363734-16363756 GGTTTGTTTTGGTCTGAAAAAGG + Intergenic
1065279305 10:24118238-24118260 GGTAAGATGTGGTTGCAATAGGG + Intronic
1065761094 10:28983928-28983950 ACTAAGATTTGGTCTGGAGAGGG + Intergenic
1066091113 10:32021649-32021671 TTTAAGATTTTGTTTGAATATGG - Intronic
1066421363 10:35267554-35267576 GGGTAGATTTGGTCTGAGTCTGG + Intronic
1067335127 10:45355327-45355349 TGTAAGATTTCATCTGAAAAAGG + Intergenic
1070501237 10:77074489-77074511 AGTAATATTTGGCCTGAAGAAGG + Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1073210102 10:101793309-101793331 GGAGAGGTTTGGTCTGAAGAGGG + Intronic
1077997183 11:7464123-7464145 GGTAAAATTAGGTCATAATAGGG + Intronic
1079520463 11:21320461-21320483 GAAAATATTTGGTGTGAATATGG + Intronic
1080925836 11:36755001-36755023 GGAAACAGTTGGTTTGAATAAGG + Intergenic
1086987316 11:93264346-93264368 GGAAAAATTTGGACTGAATGAGG + Intergenic
1089407350 11:118209286-118209308 GGTAAGATTTGGTCTGAATAAGG - Intronic
1090323861 11:125868069-125868091 GGAAAAATTTGGACTGAATGAGG - Intergenic
1090996539 11:131870945-131870967 GGTAAGATTGGGTCTATTTAAGG + Intronic
1092586525 12:9906518-9906540 GGGAAGATTTGGACTGAACGAGG - Intronic
1094836019 12:34322450-34322472 GGTAAGATCAGGTATGAATGGGG - Intergenic
1098778738 12:74655951-74655973 GGTAAGTGTTGGTGAGAATATGG + Intergenic
1099277461 12:80595332-80595354 TCTAAGATTTGTTATGAATATGG + Intronic
1101637007 12:106552100-106552122 GGTAAGTGTTGGTATGGATAAGG + Intronic
1101863991 12:108506457-108506479 GCTGGGATTTGGTCTGATTAAGG - Intergenic
1102315561 12:111884531-111884553 GGGAAGATTTAGTCAGAATTAGG + Intronic
1103181457 12:118915754-118915776 AGTAGGATTTGGTCTGGCTAGGG - Intergenic
1106276265 13:28210861-28210883 AGTAAAATTAGGTCTGAATTGGG + Intronic
1110509308 13:76330096-76330118 GGTAAGAATGGGCTTGAATATGG - Intergenic
1111976772 13:94974571-94974593 GGCAAGATTTGGAATGAAGAAGG - Intergenic
1113374741 13:109754431-109754453 GGTACGATAGGGACTGAATATGG - Exonic
1114817502 14:25977956-25977978 GGTAAAAGTTGGTGTGAGTATGG - Intergenic
1116595331 14:46835468-46835490 AGTAAGTTCTGGTCTAAATATGG + Intergenic
1117059711 14:51949729-51949751 AGTAAGATTTGTTCAGAATGTGG + Intronic
1121382215 14:93482702-93482724 GGTAAGAAGTGGCCTGAATGGGG - Intronic
1122382549 14:101319199-101319221 GGAAACATTTGGACTGAATGAGG + Intergenic
1124049770 15:26186235-26186257 AGCAAGATTTAGTCTGAAGAAGG + Intergenic
1126811318 15:52408047-52408069 GCTACGATTAGGTATGAATATGG - Exonic
1127001315 15:54510261-54510283 GGGAAGATTTGGTGTGAATCTGG - Intronic
1129889592 15:79063020-79063042 GGTAAGATTTGGCCTGAGTAAGG - Intronic
1137044019 16:35639664-35639686 GGTAAGGCTGGGTCTGAGTAAGG - Intergenic
1140120695 16:72080793-72080815 GGGAAGATTTGGACTGAACAAGG + Intronic
1140121190 16:72084255-72084277 AGTAAAAGTTGGTCTGAATATGG - Intronic
1144771061 17:17759908-17759930 GGTAAGATTTGTGCTTATTAAGG + Intronic
1146966017 17:37030518-37030540 GGTATGATTTGGTCTGTATAAGG + Intronic
1149672803 17:58430447-58430469 GGGAAGATCTGCTCTCAATATGG + Intronic
1157349724 18:46873644-46873666 GGAAAAATTTGGACTGAACAAGG + Intronic
1159197676 18:65139245-65139267 AGTAAGATTTAGTCTAATTATGG - Intergenic
1163014634 19:14446767-14446789 GGATAGATTTGGTCTGAAGGTGG - Intronic
1164268761 19:23649411-23649433 GTTAAGATTTCATCTTAATATGG + Intronic
1166497147 19:43311923-43311945 GGGAAGATTTAGGCTGAACAAGG - Intergenic
930906274 2:56572171-56572193 GGTAAGAAGTGGTCATAATATGG + Intergenic
935682011 2:105646364-105646386 GTTAGGATTTGTTCTGCATAGGG + Intergenic
936716557 2:115193605-115193627 GGAAAAATTTGGACTGAATGAGG - Intronic
938386305 2:130869738-130869760 GGGACGACTTGGTCTGAATGCGG - Intronic
940193232 2:151064656-151064678 AGTAAGATAAGGCCTGAATATGG - Intergenic
941422980 2:165306071-165306093 GGAAAGAATTGGTCTCAATGTGG + Intronic
941924368 2:170881295-170881317 AGTTAGATTTGTTTTGAATAAGG - Intergenic
942014098 2:171793626-171793648 GGGAATTTTTGGTCTGTATAAGG - Exonic
944330090 2:198455312-198455334 GGGAAGATTTTTACTGAATATGG - Intronic
945606183 2:211935352-211935374 GGTAAGATATGCTCTCAATGCGG + Intronic
946561642 2:220920669-220920691 GGCAAGCTTTGGTTTGAAAATGG - Intergenic
1170442551 20:16393769-16393791 GGTAAAATTTGGACTGAGTTTGG + Intronic
1170918217 20:20649252-20649274 GGTATGGTATGGTCTGAATGAGG + Intronic
1172680804 20:36713126-36713148 TGTAAGAATTTCTCTGAATATGG - Intronic
1174759141 20:53189578-53189600 ACTAATATGTGGTCTGAATATGG - Intronic
1174808451 20:53625475-53625497 TTAAAGATTTGGTCTGAAAAAGG - Intergenic
1182104169 22:27677347-27677369 GGGAAGTTTTTGTCTGAAGAAGG - Intergenic
955927060 3:64017449-64017471 AGTAAGATTTGTTCTGACTGAGG + Intronic
959484490 3:106911023-106911045 GGTAATAATTGGTCTGGGTAAGG - Intergenic
959672547 3:108995715-108995737 GGTCAGATTTAGGGTGAATATGG + Intronic
960707157 3:120492510-120492532 GGTAAGATATGGACTAAATGAGG + Intergenic
962079532 3:132122604-132122626 GGTAGAATTTGATGTGAATACGG - Intronic
963180523 3:142350642-142350664 GGTGAGAGTTGGTATGAATTTGG + Intronic
964838853 3:160971720-160971742 GGCAAGAATTGGTCTGTATAAGG - Intronic
965660568 3:171037606-171037628 GGTAAGATGTGGTCAGATTCAGG - Intergenic
974013443 4:56627621-56627643 GCTCAGATGTGGTTTGAATAAGG - Intergenic
975730925 4:77336476-77336498 GGAAAAATTTGGACTGAATGAGG - Intronic
976980840 4:91225930-91225952 GGTAACATATGGTCTGAATAAGG + Intronic
977964065 4:103122519-103122541 GCTAATATTTGTTCTGCATACGG + Intronic
979035996 4:115718571-115718593 GGTAATATCTGGTTTGAATCTGG - Intergenic
979821036 4:125172224-125172246 GGTAAGAATTTGTGTGCATAGGG + Intergenic
981605846 4:146539159-146539181 GGTCAGAGTTTGTCAGAATAAGG - Intergenic
981814200 4:148810475-148810497 GTTAAGATATAGTCTGAATAAGG + Intergenic
982874629 4:160630231-160630253 TGTAAGATTTGGACTGACTTAGG - Intergenic
983980452 4:173989536-173989558 GATAAATTTTGTTCTGAATATGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
988035036 5:25817060-25817082 GGTAAGACTTCTTTTGAATAAGG - Intergenic
988525529 5:31983656-31983678 GGTAAGGTTTGGTTTGATTATGG + Exonic
990269472 5:54120041-54120063 GGTTAGATGTGGTCAGAGTATGG - Intronic
992248373 5:74852372-74852394 GGTAAGAATTGTACTGAATCTGG - Intronic
993495492 5:88604275-88604297 AGCAAGATTTTGTTTGAATAAGG - Intergenic
996005098 5:118410412-118410434 GGTAAGATTAGTTCTCAAGAAGG - Intergenic
1003289696 6:4769415-4769437 GCCAAGTATTGGTCTGAATACGG + Intronic
1004422242 6:15481091-15481113 GGTAAGATTTGCTCCCAATGAGG - Intronic
1004692481 6:18004249-18004271 GGCTTGATTTGGTCAGAATAGGG + Intergenic
1007660045 6:43478310-43478332 AGAAACATTTGGTCTGAAAAGGG + Intronic
1007883132 6:45189534-45189556 CATAAGATGGGGTCTGAATAAGG + Intronic
1008844359 6:55944191-55944213 TGTAAGTTTTGGTCAGAAAAGGG - Intergenic
1011072375 6:83399968-83399990 GGTAAGATGAGGTCTGAGAATGG - Intronic
1011871229 6:91895609-91895631 GGTAAAATGTGGACTGAATCAGG + Intergenic
1013655888 6:112245921-112245943 GAGAGGATTTGGGCTGAATATGG + Intronic
1014011894 6:116485481-116485503 GGTAAGATCTGAACAGAATATGG - Intergenic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1021183416 7:17534689-17534711 GGTAATATTCTGTCTGAATGCGG - Intergenic
1021727218 7:23559775-23559797 GGTAAGATGTTGTCTTATTATGG + Intergenic
1023140476 7:37097138-37097160 GGTAAGATCTTGTAAGAATATGG - Intronic
1023601398 7:41884988-41885010 AGTAAAATTTGGTCTGATTCCGG + Intergenic
1024006905 7:45231333-45231355 GGTAGGACTTGTTCTGACTAAGG - Intergenic
1029894534 7:103968599-103968621 GGTTAGATTAGATTTGAATAAGG - Intronic
1031942484 7:127803666-127803688 GGTAAAATTAGGCCTGAATGGGG + Intronic
1035128772 7:156631173-156631195 TGGAAGATTAAGTCTGAATAGGG + Intergenic
1036104604 8:5826310-5826332 GGAAAAATTTGGACTGAATGAGG - Intergenic
1036234902 8:7030081-7030103 TTAAAGAGTTGGTCTGAATAAGG + Intergenic
1039482357 8:37883903-37883925 GGCAAGATTTTTTCAGAATATGG - Intronic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1045980066 8:108174742-108174764 AATAAGATTAGGTTTGAATAAGG + Intergenic
1046253194 8:111661538-111661560 GGTAAGATTTGATGTCAATATGG + Intergenic
1046259817 8:111752829-111752851 GATATGTTTTGGTCTGAATAAGG - Intergenic
1050174166 9:2852688-2852710 GGGAAGTTTAGGTCTTAATAAGG + Intergenic
1052287313 9:26800919-26800941 GGGAAGAGTTGCTCTGAATGAGG + Intergenic
1055208207 9:73759514-73759536 TGTAAGAGTTTGTATGAATAGGG - Intergenic
1061726434 9:132584517-132584539 GGGAAGACTTGGTCCAAATAGGG - Intronic
1187217159 X:17288380-17288402 GGGAAGATTTGTTATGGATATGG - Intergenic
1188026664 X:25217219-25217241 GGTAAGAGTTTCTTTGAATATGG - Intergenic
1192617455 X:72642482-72642504 GGTAAGATGTTGGCTAAATAGGG + Intronic
1201488627 Y:14517941-14517963 GAGGAGATTTGATCTGAATAGGG - Intergenic