ID: 1089409460

View in Genome Browser
Species Human (GRCh38)
Location 11:118227690-118227712
Sequence AATTACCTCAAGTTTAGACT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089409460 Original CRISPR AATTACCTCAAGTTTAGACT AGG Exonic