ID: 1089410154

View in Genome Browser
Species Human (GRCh38)
Location 11:118234349-118234371
Sequence GAGTTTCCCTGAGACCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089410154_1089410164 30 Left 1089410154 11:118234349-118234371 CCCCTGAGGTCTCAGGGAAACTC 0: 1
1: 1
2: 0
3: 19
4: 195
Right 1089410164 11:118234402-118234424 GAGGATAAGAAAGAGTTTCCAGG 0: 1
1: 0
2: 4
3: 41
4: 321
1089410154_1089410161 2 Left 1089410154 11:118234349-118234371 CCCCTGAGGTCTCAGGGAAACTC 0: 1
1: 1
2: 0
3: 19
4: 195
Right 1089410161 11:118234374-118234396 GAGAAGGGGCTATTTCAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 240
1089410154_1089410163 11 Left 1089410154 11:118234349-118234371 CCCCTGAGGTCTCAGGGAAACTC 0: 1
1: 1
2: 0
3: 19
4: 195
Right 1089410163 11:118234383-118234405 CTATTTCAGCTGGGTCTTGGAGG 0: 1
1: 0
2: 3
3: 20
4: 262
1089410154_1089410160 1 Left 1089410154 11:118234349-118234371 CCCCTGAGGTCTCAGGGAAACTC 0: 1
1: 1
2: 0
3: 19
4: 195
Right 1089410160 11:118234373-118234395 AGAGAAGGGGCTATTTCAGCTGG 0: 1
1: 0
2: 2
3: 26
4: 237
1089410154_1089410162 8 Left 1089410154 11:118234349-118234371 CCCCTGAGGTCTCAGGGAAACTC 0: 1
1: 1
2: 0
3: 19
4: 195
Right 1089410162 11:118234380-118234402 GGGCTATTTCAGCTGGGTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089410154 Original CRISPR GAGTTTCCCTGAGACCTCAG GGG (reversed) Intronic
900094124 1:933492-933514 TAGTTTCCCAGAGACTCCAGAGG - Intronic
900106585 1:984055-984077 GAGTTGGCCTGAGGCTTCAGGGG + Intergenic
901509574 1:9710049-9710071 CAGGTGCCCTGAGACCTGAGAGG - Intronic
901756183 1:11442978-11443000 GAGTTTGGCTGAGCCCTGAGTGG + Intergenic
902341098 1:15784247-15784269 AACTTTCCCTGAACCCTCAGGGG + Intronic
903011344 1:20332825-20332847 GATCTTCCCTGAGACCACTGAGG + Exonic
904331268 1:29759042-29759064 AACTTTCCCAGAGACCTGAGTGG + Intergenic
909942233 1:81624109-81624131 CAGTCTCCCAGAGACCTCAAAGG + Intronic
911039938 1:93583452-93583474 GACTTTCCCTGGGACCACAAAGG - Intronic
912541767 1:110421549-110421571 CAGTTTCTCTGAGAACTCAGAGG - Intergenic
912760095 1:112359158-112359180 GACTCTCCCTGATGCCTCAGAGG + Intergenic
916843783 1:168627742-168627764 AAGTTTCCAGGAAACCTCAGAGG + Intergenic
917723040 1:177804082-177804104 TAGTCTCCCTAAGAACTCAGAGG - Intergenic
917804249 1:178599011-178599033 GAGTCTCCCTGAGGCTGCAGTGG + Intergenic
918044963 1:180936056-180936078 GGGTGTCCCTGGGACCCCAGTGG + Exonic
918396337 1:184116917-184116939 GAGTTTCCCTGATACCTGCTTGG - Intergenic
923843032 1:237695379-237695401 TTGTTTCCCTGAGTGCTCAGAGG + Intronic
1063943533 10:11155498-11155520 GAGTTCTCCAGAGACCTCAAAGG + Intronic
1064648158 10:17481536-17481558 CAGTCTCCCTGAGAACTAAGGGG + Intergenic
1066796691 10:39129867-39129889 GTGTTTCCCCCAGGCCTCAGTGG - Intergenic
1067566852 10:47345767-47345789 GACTTTCCCTAATACCACAGGGG + Intergenic
1068150487 10:53124400-53124422 GAGTTTCGCTCAGATCTCATTGG - Intergenic
1071175701 10:82924237-82924259 GTTTGTCACTGAGACCTCAGAGG + Intronic
1072359772 10:94648040-94648062 AAGTTTCCCTAAGCTCTCAGAGG - Intergenic
1072434908 10:95405998-95406020 GAGTCTCCCCAAGACATCAGAGG + Intronic
1072740855 10:97908216-97908238 CAGTTCCCCTCAGGCCTCAGAGG - Intronic
1075157713 10:119992403-119992425 GAATTTCCCTGGGACCTCAATGG - Intergenic
1075816840 10:125271279-125271301 GCCTTTCCCTCAGACCCCAGAGG - Intergenic
1076026940 10:127123254-127123276 GAATTTCCAAGAAACCTCAGAGG - Intronic
1078254180 11:9643183-9643205 GACTTTTCCTGAAACCTCATTGG + Intergenic
1078719981 11:13875476-13875498 GACTTGCCCCGAGGCCTCAGAGG - Intergenic
1078791921 11:14552123-14552145 GAGTTTCCCTGAGGCTGGAGAGG + Intronic
1079089610 11:17471395-17471417 GAGCTATCCTGTGACCTCAGTGG + Intronic
1079382062 11:19947130-19947152 GAGACTCCCTGGGAGCTCAGTGG - Intronic
1080250384 11:30227140-30227162 CAGTCTCCCTGAAAACTCAGAGG + Intergenic
1080644612 11:34179351-34179373 AAGAGTCCCTGGGACCTCAGGGG + Intronic
1081232086 11:40598065-40598087 TAGTTTCCCTGCTACTTCAGAGG - Intronic
1082837883 11:57664838-57664860 GAGTTTCCCTTGTCCCTCAGGGG - Intergenic
1083712089 11:64555807-64555829 GAGTTTCCCCGAGGCATCACAGG + Exonic
1084456050 11:69268845-69268867 CAGCTTCCCTGAGACCGCAGAGG + Intergenic
1085522682 11:77147564-77147586 GATTTTCCCGCAGACCTAAGAGG - Intronic
1086755023 11:90549946-90549968 GAGTTTCCCTGTGGGCTAAGTGG - Intergenic
1089410154 11:118234349-118234371 GAGTTTCCCTGAGACCTCAGGGG - Intronic
1091384741 12:86137-86159 CAGCTTCCCTGAGACATTAGTGG - Intronic
1092239420 12:6828076-6828098 TAGTTACCCCCAGACCTCAGGGG + Intronic
1092260612 12:6951610-6951632 TGGTTTCACCGAGACCTCAGTGG + Exonic
1094503165 12:31038090-31038112 GAAATTCCCTGGTACCTCAGAGG - Intergenic
1096716713 12:53495792-53495814 GAGTTCCCCTGAGAACTTGGGGG + Intronic
1101294392 12:103406074-103406096 GCCTTTCCCTGAGACTTCATAGG + Intronic
1101998001 12:109538872-109538894 GAGGTGCCCTGAGGCCACAGGGG - Intergenic
1102420505 12:112799630-112799652 GCCTTTCCCTCAGAGCTCAGAGG + Intronic
1106540077 13:30682554-30682576 GATTGTCCCTGAGACCTTTGAGG + Intergenic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1114439994 14:22738472-22738494 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1115298556 14:31857813-31857835 GAACTTCCCAGAGACTTCAGTGG - Intronic
1115769972 14:36658091-36658113 GAGTTTCCCTGAAACTGCAGCGG - Intronic
1116187122 14:41610640-41610662 TACCTTCCCTGGGACCTCAGAGG - Intronic
1117217901 14:53570628-53570650 TAGTTCCCCTGAGTCCTCTGTGG - Intergenic
1119752728 14:77091791-77091813 CAGTTTTCCTGAGAACTGAGAGG + Intergenic
1120259104 14:82159912-82159934 CAGTTTCCATGAGGACTCAGAGG - Intergenic
1121138053 14:91516279-91516301 CAGTTTCCCTGAAGGCTCAGAGG - Intergenic
1121581548 14:95035862-95035884 GAGTTTACCTGTGGCCACAGTGG - Intergenic
1122883394 14:104700014-104700036 GAGTGGGCCTGAGACCTCAAGGG + Intronic
1125077649 15:35638300-35638322 GAGTATCTCTGAGAACTAAGAGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127787590 15:62369911-62369933 CTATTTCCCTGAGACCTCTGTGG - Intergenic
1129300734 15:74624079-74624101 CAGCCTCCCTGAGGCCTCAGAGG + Intronic
1130306312 15:82714255-82714277 GTGATTCCCTGAGAGCTCTGGGG - Intergenic
1131587642 15:93713540-93713562 GACTTTCCCTGAAAACTCAGAGG + Intergenic
1132069302 15:98761638-98761660 GAGTCTGCCTCAAACCTCAGTGG - Intronic
1137435218 16:48449037-48449059 GAGTTTCCCAGCGACATCATCGG - Intergenic
1137952523 16:52797305-52797327 GAGGCTGCCTGAGACCACAGTGG + Intergenic
1138314273 16:56055086-56055108 GAGGTTCCCTCTGACCTCAGCGG - Intergenic
1140134081 16:72189795-72189817 CAGTCTCCCTGATAACTCAGAGG + Intergenic
1140536042 16:75710891-75710913 AAGTTTTCTAGAGACCTCAGAGG + Intronic
1141135705 16:81463828-81463850 TGCTTTTCCTGAGACCTCAGGGG + Intronic
1142246413 16:88972177-88972199 CTGCTTCCCTGAGGCCTCAGTGG - Intronic
1142606111 17:1082055-1082077 TAGTTTTCCTGAAACTTCAGGGG - Intronic
1143261616 17:5603443-5603465 TAATTTCCCTCAGAGCTCAGTGG + Intronic
1143513804 17:7409302-7409324 GAGCTTCCCTGATCCTTCAGGGG - Intronic
1144256803 17:13476333-13476355 TAGTCTCCCTGAGAACTCAGAGG - Intergenic
1144522810 17:15965466-15965488 GAGCTGCCCTGAGAGCTCAGGGG + Intronic
1146552893 17:33797313-33797335 ACGTTTCCCTGACATCTCAGAGG - Intronic
1152382058 17:79947195-79947217 GACTGCCCCAGAGACCTCAGGGG + Intronic
1152383430 17:79954465-79954487 CAGTTTCCTTGAGAGCCCAGGGG - Intronic
1152607781 17:81301715-81301737 GAGGTTCCCAGAGACTGCAGAGG - Intergenic
1152609697 17:81309599-81309621 GAGTTTCTCTGAGGCCCAAGTGG - Intergenic
1153493892 18:5677648-5677670 AAGTGACCCTCAGACCTCAGTGG - Intergenic
1154975925 18:21457918-21457940 TAGTTTGCCTGAGATCACAGAGG + Intronic
1157959227 18:52133958-52133980 TAGCCTCCCTGAGAACTCAGAGG + Intergenic
1160543406 18:79637920-79637942 GAGTCCCCCTGAGACCTGGGCGG - Intergenic
1162910102 19:13843626-13843648 GAGTTTCCCAGAGGTCCCAGCGG - Intergenic
1167123190 19:47531389-47531411 GGGTTCCTCTGAGATCTCAGGGG - Intronic
1167308803 19:48724385-48724407 GAGTTTCCGGAAGAACTCAGTGG + Exonic
1168560254 19:57376180-57376202 GAGTTCTCCTGAGATCTCATGGG - Intronic
925781083 2:7382443-7382465 GAGTTTCAAGGAGAACTCAGGGG - Intergenic
926982559 2:18586800-18586822 GAGTCCCCCTGCAACCTCAGTGG - Intronic
928128817 2:28634410-28634432 CTTTTCCCCTGAGACCTCAGGGG + Intronic
928242714 2:29600667-29600689 GGGTGGCCCTGAGAGCTCAGAGG + Intronic
930506863 2:52293716-52293738 CAGTCTTCCTGAGAACTCAGAGG + Intergenic
932574649 2:72956017-72956039 GAGATTCACTGAGACCACAGGGG + Intronic
935594775 2:104869920-104869942 GAGGCACCCTGAGAACTCAGAGG - Intergenic
937370304 2:121293062-121293084 GAAGTTTCCTGAGGCCTCAGTGG - Intergenic
941508733 2:166378918-166378940 GATTTTCCCTGTGAGCTCATAGG + Intergenic
941870292 2:170377389-170377411 GAGTTCCCCTAAGACAACAGTGG - Intronic
942591331 2:177550023-177550045 GAGCTATCCTGAGAACTCAGGGG - Exonic
942983088 2:182105974-182105996 GATTTTCCTTCAGCCCTCAGAGG - Intronic
944104898 2:196069116-196069138 GTGTTTCTCCGAGACCTCTGAGG - Intergenic
946519487 2:220449501-220449523 GATTTTCACTGTGTCCTCAGTGG - Intergenic
946782349 2:223204932-223204954 GAGAGTCCCTTAGACCTCATGGG + Intergenic
947236368 2:227945524-227945546 CAGTCTCCCTGAGAACTCAGAGG + Intergenic
1170876567 20:20255227-20255249 GAGTGGCCCTGTGATCTCAGAGG - Intronic
1171398295 20:24854592-24854614 CAGACTCCCTGAGAACTCAGAGG - Intergenic
1172834520 20:37864411-37864433 GCGTTTTCCTGAGACCTCAAGGG - Intronic
1173175904 20:40764781-40764803 GAGTTTTCTAGAGCCCTCAGTGG + Intergenic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1175461508 20:59155099-59155121 CAGTTTCCCTGACACCTGGGAGG + Intergenic
1177853684 21:26377962-26377984 GTGTTTGACTGAGACCTGAGTGG - Intergenic
1178258675 21:31078600-31078622 GAGCTACCTTGAGACCACAGAGG + Intergenic
1179999412 21:44988251-44988273 GGGTTTCCCAAAGTCCTCAGGGG + Intergenic
1180248565 21:46564408-46564430 GGGTCTCCCTGAGAACACAGAGG + Intronic
1181639609 22:24189717-24189739 CACTTTCTCTGAGACCTAAGGGG - Intergenic
1181693997 22:24583919-24583941 GAGTTTCAGGGAGAGCTCAGAGG + Intronic
1183186570 22:36294904-36294926 GAGCCTCCCTGAGACCGCAGGGG - Intronic
1183428349 22:37751413-37751435 GAGACCCCCTGAGAGCTCAGAGG - Intronic
1183512482 22:38244177-38244199 GTGTATCCCTGAGAACTCATAGG - Intronic
954823724 3:53353029-53353051 TAGTCTTCCTGAGAACTCAGAGG + Intergenic
956011163 3:64833136-64833158 GAATGTGCCTGAGATCTCAGTGG - Intergenic
956052144 3:65259765-65259787 GTGGTTCTCTGAGACCTGAGAGG + Intergenic
959350831 3:105260698-105260720 TAGCCTCCCTGAGAACTCAGAGG - Intergenic
962007651 3:131363538-131363560 CAGGTTCCCTGAGTCCACAGAGG - Intergenic
962658902 3:137580810-137580832 CAGTTTCCCTGAGGACCCAGGGG + Intergenic
964524310 3:157601689-157601711 GCGTTTCTCTGACATCTCAGGGG + Intronic
964626969 3:158768871-158768893 GAGTATCCCTGGCACATCAGTGG + Intronic
965715017 3:171593847-171593869 GAGTTTACCTGTGGCCACAGGGG + Intergenic
966961642 3:184945810-184945832 CAGTTTCCTGGAGAACTCAGAGG + Intronic
967846514 3:194047365-194047387 GGGTGTCCCTGTGAGCTCAGTGG - Intergenic
969237518 4:5876423-5876445 GAGGTTACCTGATTCCTCAGTGG + Intronic
969425237 4:7120481-7120503 GATTTTCCCTTACACCTCATTGG + Intergenic
973073983 4:45900046-45900068 TAGTCTCCCTAAGAACTCAGAGG + Intergenic
974436887 4:61868280-61868302 GAGATTCCCTGAGATCTATGGGG - Intronic
980912687 4:139007922-139007944 CAGTTTCCCTGAAGGCTCAGAGG - Intergenic
982074381 4:151724066-151724088 GAGTTTGCATGAGACCTCTAAGG + Intronic
988494549 5:31733930-31733952 GAGTTACCATCAGACCTCACAGG + Intronic
988680203 5:33477319-33477341 CAGTCTCCTTGAGAACTCAGAGG - Intergenic
989414378 5:41156332-41156354 GAGTTTCCCTCAGAACTGAAAGG - Intronic
991247210 5:64520847-64520869 GAGTGTCCCTGTCACCCCAGGGG - Intronic
992017896 5:72594485-72594507 GAGTGTCCCTCAGCCCACAGGGG + Intergenic
997510065 5:134447967-134447989 GAGAAGCTCTGAGACCTCAGGGG - Intergenic
999240368 5:150124212-150124234 CACTTTCCCTGAGGCCTCTGGGG + Intronic
999385493 5:151151193-151151215 GAGCTTCCCAGAACCCTCAGAGG - Intronic
999456131 5:151717697-151717719 GAGCCTCCCTGAGACCACAGGGG + Intergenic
1001732617 5:173971663-173971685 GAATTTCAATGAGACTTCAGAGG - Intergenic
1002546518 5:179949717-179949739 AAGTTATCCTGAGACTTCAGAGG + Intronic
1002997126 6:2297383-2297405 GAGTTTTCCTGAGACTTCACTGG + Intergenic
1004571909 6:16854365-16854387 GAGTTTCCCAAAGACCTTTGAGG + Intergenic
1005133557 6:22540132-22540154 CATTTTCCCTGAGTCCTCAGAGG + Intergenic
1010397630 6:75409968-75409990 CAGTCTCCCTGAGAATTCAGGGG - Intronic
1011208894 6:84933253-84933275 GAGTTGCCCTTGGACTTCAGAGG - Intergenic
1013085381 6:106852412-106852434 CAGTCTCTCTGAGAACTCAGAGG - Intergenic
1014451321 6:121585293-121585315 AAGCTTCCCTGAGACCACAGTGG + Intergenic
1016729843 6:147417528-147417550 CAGCTTCCCGGAGACCTCAGAGG - Intergenic
1017450636 6:154551703-154551725 GTGTCTCCCTGAAACCTCACAGG - Intergenic
1017564433 6:155668820-155668842 GAGCTTCCCAGAGGGCTCAGGGG + Intergenic
1017984702 6:159433806-159433828 CAGTCTCCCTGAGAATTCAGAGG + Intergenic
1019924471 7:4182993-4183015 CAGTCTCCCTGAGGGCTCAGAGG + Intronic
1021523822 7:21564210-21564232 AACTTTACCTGAGACCTCTGAGG + Exonic
1021584565 7:22193888-22193910 GAGTTTCCCTGCAGCCACAGAGG - Intronic
1023493411 7:40768356-40768378 GAGTTTCCTAGAGTCCTCAATGG + Intronic
1024009180 7:45253171-45253193 CAGTGTCCCTCAGACCTCAAGGG - Intergenic
1024535125 7:50424062-50424084 GAGTCTCCCAGAGGCCTCTGGGG - Intergenic
1024996741 7:55278223-55278245 GGGGTGCCCTGGGACCTCAGGGG + Intergenic
1025640250 7:63360565-63360587 GCTTTTCCCTGAGAAGTCAGTGG - Intergenic
1025642449 7:63387528-63387550 GCTTTTCCCTGAGAAGTCAGTGG + Intergenic
1028653052 7:93171896-93171918 AAGCCTCCCTGAGAACTCAGAGG + Intergenic
1031572741 7:123379180-123379202 TAGTTTATCAGAGACCTCAGAGG + Intergenic
1033668007 7:143461961-143461983 CAGCCTCCCTGAGAACTCAGAGG + Intergenic
1035181742 7:157094300-157094322 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1036123515 8:6043243-6043265 GAGTGTCCCAGAGAACCCAGTGG + Intergenic
1036176278 8:6541210-6541232 GGGTTTCCCTGACACAGCAGGGG + Intronic
1036692995 8:10956468-10956490 GAGTTTCCCTGAGGCTGGAGAGG + Intronic
1036696430 8:10978109-10978131 GAGTGTCACTAGGACCTCAGTGG - Intronic
1039322248 8:36445284-36445306 CAGTCTTCCTGAGAACTCAGAGG + Intergenic
1040432910 8:47361690-47361712 GAGAGTCACTGAGATCTCAGAGG + Intronic
1041248030 8:55907443-55907465 GAGCTTCCTTGACACCTCACAGG - Intronic
1045242576 8:100415623-100415645 GAGTTTACCAGGGACCTCAGTGG + Intergenic
1047880777 8:129190538-129190560 TAGTTTAGATGAGACCTCAGAGG + Intergenic
1048308800 8:133302392-133302414 ATTTTTCCCTGAGACTTCAGAGG - Intergenic
1048843497 8:138584959-138584981 GGGTTTCCCAAAGACCTCCGAGG - Intergenic
1049014541 8:139910245-139910267 GAGTTTCCCGGAGTCCCCTGGGG - Exonic
1050983164 9:12046468-12046490 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1052413336 9:28148553-28148575 AAGTTTCCCTGAGTCTCCAGGGG - Intronic
1053361605 9:37491299-37491321 GAATCTGCCTGATACCTCAGAGG + Intronic
1054764227 9:69029810-69029832 CAGTTTCTCTGAGAACTCAGAGG + Intergenic
1055224970 9:73984698-73984720 GAGGTGACTTGAGACCTCAGTGG - Intergenic
1056576417 9:87858695-87858717 GGGTTTCCCTGAGTCTCCAGGGG + Intergenic
1057166076 9:92926605-92926627 GAGCTTCTCTGAGACCTGAAAGG - Intergenic
1057572615 9:96216088-96216110 GAGTTTCCCTGAGTTCCCATGGG + Intergenic
1057867851 9:98695420-98695442 GAGGTGCGCTGAGAGCTCAGTGG - Intronic
1060011994 9:120051839-120051861 GAGAAGTCCTGAGACCTCAGTGG - Intergenic
1060892609 9:127198341-127198363 GACTGTCTCTCAGACCTCAGAGG - Intronic
1062253846 9:135611679-135611701 GGCTCTTCCTGAGACCTCAGTGG - Intergenic
1186075052 X:5869418-5869440 GAGTTTCCATGCATCCTCAGAGG - Intronic
1186567684 X:10681448-10681470 GTTGTTGCCTGAGACCTCAGTGG + Intronic
1190988290 X:55520856-55520878 GAGTTTCTCTGAGATTTTAGGGG + Intergenic
1195706714 X:107742805-107742827 GAGTTTCCCAGATTCCTGAGGGG + Intronic
1195766180 X:108298638-108298660 GAGTTTCCCAGATTCCTGAGGGG - Intronic
1196066173 X:111467035-111467057 GAGCTTTCCTGAGCTCTCAGAGG - Intergenic
1196934929 X:120720060-120720082 GAGTATCCCTGACACCTTGGTGG + Intergenic
1199615111 X:149649916-149649938 GAGGTTCCCTGAGGACTCTGGGG + Intergenic
1199680273 X:150219701-150219723 GAATTTTCCTCAGACCACAGAGG - Intergenic
1200184672 X:154174641-154174663 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200190325 X:154211779-154211801 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200196076 X:154249581-154249603 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200201731 X:154286699-154286721 GGGTTTCCATGGGCCCTCAGGGG - Intronic
1200916808 Y:8578467-8578489 AATTATACCTGAGACCTCAGAGG - Intergenic