ID: 1089416425

View in Genome Browser
Species Human (GRCh38)
Location 11:118296010-118296032
Sequence CCTCATCTCCTGCAGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089416422_1089416425 -1 Left 1089416422 11:118295988-118296010 CCTTAGCAGCATTTAAAGAGCAC No data
Right 1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089416425 Original CRISPR CCTCATCTCCTGCAGCTAGA GGG Intergenic
No off target data available for this crispr