ID: 1089418849

View in Genome Browser
Species Human (GRCh38)
Location 11:118315941-118315963
Sequence TACCCAGTCCATCCCCAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089418849_1089418850 -9 Left 1089418849 11:118315941-118315963 CCTCTCTGGGGATGGACTGGGTA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1089418850 11:118315955-118315977 GACTGGGTAAATGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 145
1089418849_1089418853 15 Left 1089418849 11:118315941-118315963 CCTCTCTGGGGATGGACTGGGTA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1089418853 11:118315979-118316001 CCTGCCCCGTTCACAGATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089418849 Original CRISPR TACCCAGTCCATCCCCAGAG AGG (reversed) Exonic
903304973 1:22406889-22406911 TACCCAATCCACCCCCACAAGGG - Intergenic
903885678 1:26539808-26539830 TGCCCAGTCCACTCCCAGAAGGG - Intronic
906305600 1:44716771-44716793 TTCCTAGTCCACCACCAGAGTGG + Intronic
907775766 1:57512915-57512937 TTCCCAGACAGTCCCCAGAGAGG - Intronic
915584412 1:156836482-156836504 TACCCTGTCCTTCCACACAGAGG - Intronic
921203618 1:212829429-212829451 TACGTTGTCCATCCCCACAGTGG - Intergenic
921949448 1:220914557-220914579 TACACAGACCATTGCCAGAGAGG - Intergenic
1064148982 10:12847700-12847722 TGCTCCGTCCGTCCCCAGAGAGG - Intergenic
1065359108 10:24872410-24872432 TACTCAGTCCACCCCCAGCTAGG - Intronic
1065917595 10:30366011-30366033 GAGCCAGCCCCTCCCCAGAGGGG + Intronic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1071672607 10:87622987-87623009 TACCCAGTTGATGCCCAGCGTGG - Intergenic
1072638584 10:97193673-97193695 TACCCATTCAATCCCCACACTGG - Intronic
1072912825 10:99519343-99519365 GACACAGTCCATGCCCAGAGTGG - Intergenic
1075370529 10:121931098-121931120 TTCCCAGTCCTTTCCCAGACCGG + Intergenic
1075402786 10:122172995-122173017 TACCCAGAACATCCTCAGACAGG + Intronic
1075799643 10:125145406-125145428 GACTCAGTCAGTCCCCAGAGAGG - Intronic
1077249752 11:1555721-1555743 GCCCCAGTCCAGCCACAGAGTGG - Exonic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1078339082 11:10486243-10486265 TGCCCAGACAAGCCCCAGAGTGG - Intronic
1079359434 11:19758342-19758364 CACACAGTCCCTCCTCAGAGAGG - Intronic
1083937495 11:65877665-65877687 TGGACAGACCATCCCCAGAGTGG - Intergenic
1084132468 11:67147219-67147241 TAACCTGACCATTCCCAGAGTGG - Intronic
1085532687 11:77201290-77201312 TACAGAGACCATCACCAGAGTGG - Intronic
1085803396 11:79612217-79612239 TCCCTAGTCCATACCCAAAGGGG + Intergenic
1089153685 11:116384790-116384812 TCCCCATTGCATCCTCAGAGCGG + Intergenic
1089418849 11:118315941-118315963 TACCCAGTCCATCCCCAGAGAGG - Exonic
1090048024 11:123353133-123353155 TTCCCAGTCCCTTCCCAGTGGGG - Intergenic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102583921 12:113910086-113910108 TTCCCACGCCATCCTCAGAGAGG + Intronic
1102793467 12:115668130-115668152 TACTCAGACCATCTCCAGAAAGG + Intergenic
1102867079 12:116382955-116382977 TTCCCACTCGATCCTCAGAGAGG - Intergenic
1104524982 12:129512726-129512748 TCCTCAGTCCATCCCCATATGGG + Intronic
1104955834 12:132465434-132465456 TACCTGGCCCATCCCCAGAACGG - Intergenic
1105404690 13:20123674-20123696 TATCCAGGGCATCCCCAGACAGG + Intergenic
1105746002 13:23377452-23377474 TACTCAGTCCACTACCAGAGTGG + Intronic
1106182280 13:27380135-27380157 TTCCCATCCCATCCCCAGGGGGG + Intergenic
1111997419 13:95178561-95178583 CAGCCAGTCCATCCCCTGACAGG - Intronic
1119510051 14:75203894-75203916 TTCCCAGTCACTTCCCAGAGAGG - Intergenic
1121302402 14:92881810-92881832 TCCCAAGCCCATCCCCAGAAGGG - Intergenic
1122857235 14:104565790-104565812 CACCCTCTCCTTCCCCAGAGAGG + Intronic
1123473460 15:20571173-20571195 GAGCCAGGCCCTCCCCAGAGAGG - Intergenic
1123644549 15:22429180-22429202 GAGCCAGGCCCTCCCCAGAGAGG + Intergenic
1123665866 15:22609088-22609110 GAGCCAGCCCCTCCCCAGAGAGG + Intergenic
1123733757 15:23166184-23166206 GAGCCAGGCCCTCCCCAGAGAGG - Intergenic
1123751889 15:23363559-23363581 GAGCCAGCCCCTCCCCAGAGAGG - Intronic
1124284254 15:28387483-28387505 GAGCCAGGCCCTCCCCAGAGAGG - Intronic
1124298443 15:28524131-28524153 GAGCCAGGCCCTCCCCAGAGAGG + Intronic
1124319690 15:28703501-28703523 GAGCCAGCCCCTCCCCAGAGAGG + Intronic
1124489275 15:30144000-30144022 GAGCCAGCCCCTCCCCAGAGAGG - Intronic
1124520755 15:30405289-30405311 GAGCCAGCCCCTCCCCAGAGAGG + Intronic
1124537904 15:30560930-30560952 GAGCCAGCCCCTCCCCAGAGAGG - Intronic
1124564326 15:30800427-30800449 GAGCCAGCCCCTCCCCAGAGAGG - Intergenic
1124754253 15:32394324-32394346 GAGCCAGCCCCTCCCCAGAGAGG + Intronic
1124760749 15:32446656-32446678 GAGCCAGCCCCTCCCCAGAGAGG + Intronic
1124777885 15:32602407-32602429 GAGCCAGCCCCTCCCCAGAGAGG - Intronic
1124966316 15:34435775-34435797 CACCCAGTCCCAGCCCAGAGAGG + Intronic
1128385930 15:67148336-67148358 GCTCCAGTCCATCCCCAGTGTGG + Intronic
1129534775 15:76304043-76304065 TACCCAGTCCATCCCTTGCATGG - Intronic
1130276318 15:82478017-82478039 GAGCCAGCCCCTCCCCAGAGGGG + Intergenic
1130468680 15:84205410-84205432 GAGCCAGCCCCTCCCCAGAGGGG + Intergenic
1130485069 15:84394352-84394374 GAGCCAGCCCCTCCCCAGAGGGG - Intergenic
1130495595 15:84468169-84468191 GAGCCAGCCCCTCCCCAGAGGGG - Intergenic
1130590973 15:85210009-85210031 GAGCCAGCCCCTCCCCAGAGGGG + Intergenic
1131188390 15:90294223-90294245 GAGCCAGCCCCTCCCCAGAGGGG - Intronic
1138414135 16:56861574-56861596 TTCCCAGCCCCTCCTCAGAGAGG - Intergenic
1140275096 16:73501899-73501921 TGCAAAGTCCTTCCCCAGAGAGG - Intergenic
1141104334 16:81220869-81220891 TACCCATTCTCTCCCCAGCGTGG + Intergenic
1142594462 17:1022776-1022798 TACCCAGGCCAGCCACAGATAGG + Intronic
1143680881 17:8475187-8475209 TACCATGTCCATCCCCCAAGGGG - Exonic
1146514347 17:33477751-33477773 TACCCTGACCATCCCTAGTGTGG - Intronic
1146607326 17:34271857-34271879 TACCCTGTCCTTTCTCAGAGTGG + Exonic
1146689801 17:34865485-34865507 TTCCCAGTTCAGCCCCAGGGTGG - Intergenic
1147597308 17:41725307-41725329 TACCCAGCCCATCCCCCTGGTGG + Intronic
1147840446 17:43367930-43367952 TACCAAGTCGATGCGCAGAGTGG + Intergenic
1148429903 17:47634276-47634298 AACACAGTTCTTCCCCAGAGAGG + Intergenic
1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG + Intronic
1154388229 18:13914479-13914501 TCCCCACCCCATCCCCGGAGTGG - Intronic
1155087855 18:22475043-22475065 TACACAGTCCATCCCCTCTGAGG + Intergenic
1155433662 18:25788135-25788157 TGTCCAGTCCATCACCTGAGTGG + Intergenic
1157293701 18:46427139-46427161 CACCATCTCCATCCCCAGAGTGG - Intronic
1157313396 18:46569182-46569204 TACACATTCCAGCCCCAAAGAGG + Intronic
1157357578 18:46949588-46949610 TTCCCAGTCTTTCCCCATAGGGG + Intronic
1157976325 18:52331234-52331256 AATTCAGTCTATCCCCAGAGTGG + Intergenic
1160508670 18:79441297-79441319 TACCCAGTCCAGACACACAGGGG - Intronic
1162069719 19:8146391-8146413 TGCCCAGCCCAGCCCGAGAGTGG - Intronic
1163027140 19:14518790-14518812 TACCCAGTCCTTTCCCCGGGAGG + Intronic
1163842321 19:19618867-19618889 AACCCAGTCCAAGCCCGGAGAGG - Exonic
1163980248 19:20892640-20892662 CACTCACTCAATCCCCAGAGTGG + Intergenic
1163981574 19:20905495-20905517 TACCCACTCATTCACCAGAGTGG + Intergenic
1165375497 19:35438909-35438931 TCCCCAAACCATCCCAAGAGGGG - Intergenic
1165425678 19:35744207-35744229 AATCCAGTCCAGCCCCAGAGCGG - Intronic
1165786470 19:38464743-38464765 CCCCCAGTCCATCCCCAGACGGG - Intronic
928730774 2:34229618-34229640 TACCCAGACCACCACCAGTGTGG - Intergenic
929996284 2:46828148-46828170 AACCCAACCCATCCCAAGAGAGG - Intronic
930528388 2:52560610-52560632 TAAACAGACCATCCACAGAGTGG - Intergenic
932459209 2:71871707-71871729 TTCCCAGCCCATCCCGAGCGCGG + Intergenic
935161070 2:100529949-100529971 TTCCCAGACCATCCCCATTGTGG + Intergenic
937043386 2:118837624-118837646 GGCCCACTCCATCTCCAGAGTGG + Intergenic
938102291 2:128505233-128505255 TACACAGCCCACCGCCAGAGTGG - Intergenic
942955330 2:181766390-181766412 TACCCTTTCCTTCTCCAGAGTGG - Intergenic
943506685 2:188769292-188769314 TCCCCAGCCCCTCCCCAGAAAGG + Intronic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
1178575918 21:33790973-33790995 TACCCAGTCCTTTCACATAGGGG - Intronic
1178668056 21:34566184-34566206 TGGGCAGTCCAGCCCCAGAGTGG + Intronic
1179330418 21:40395797-40395819 TCCCCAATCCATTCCCTGAGAGG - Intronic
1180167749 21:46038810-46038832 TACCCAGTCCATGCCCCAAGAGG + Intergenic
1180929488 22:19579227-19579249 AACACAGGCCATCCCCAGGGTGG - Intergenic
1183280768 22:36930848-36930870 GTCCCAGACCATCCCCACAGCGG - Intronic
1183696925 22:39428790-39428812 TGCGCACTCCATCCTCAGAGTGG - Intronic
1184320930 22:43741740-43741762 TACCGAATCCTGCCCCAGAGTGG - Intronic
1184405449 22:44298203-44298225 TAACCTCTACATCCCCAGAGGGG - Intronic
1184636542 22:45836610-45836632 ACCCCAGTGCATCCCCAGGGGGG - Intronic
1184738428 22:46412514-46412536 TACCCAATCCTGGCCCAGAGAGG - Intronic
950391358 3:12699257-12699279 TGCCCAGTCCCTACCCACAGAGG - Intergenic
951467754 3:23020434-23020456 CACCCAATCCACCCCCACAGTGG + Intergenic
952163441 3:30719686-30719708 TACCCAGCCCATCAGCAGAAAGG + Intergenic
952712135 3:36442467-36442489 TGCTCTGTCCATCCCCACAGTGG - Intronic
953764863 3:45731019-45731041 GACCCAGCCCCTCCTCAGAGTGG - Intronic
960590786 3:119363476-119363498 TTCCAAGTCCATTCCCTGAGGGG + Intronic
962040792 3:131705561-131705583 CACCCTTTCCTTCCCCAGAGTGG - Intronic
963972346 3:151443807-151443829 TACCCTGTCCATCCAGAGGGTGG - Exonic
966181641 3:177194061-177194083 TACCGAATCCAATCCCAGAGGGG + Intronic
968959880 4:3738057-3738079 TATCCAGCCCATCCTCTGAGCGG - Intergenic
969519610 4:7668345-7668367 TCCCCATCCCAGCCCCAGAGGGG - Intronic
970195481 4:13547198-13547220 TACGGAGTCCAGGCCCAGAGTGG + Intergenic
975543272 4:75536057-75536079 TTTCCAGTCTATCTCCAGAGGGG + Intronic
976223687 4:82778558-82778580 TGGCCAGACCATCCCCAGGGAGG + Intronic
982574811 4:157096200-157096222 TAGCCAGGCCTTCCCCAGACAGG - Intronic
983922430 4:173360221-173360243 TAGCCAGTCTACCTCCAGAGGGG - Intergenic
984293420 4:177823828-177823850 TACACAGTCCATCACCAGAAGGG + Intronic
984951165 4:185008900-185008922 CACCTAGTCCATTCCCAGACCGG + Intergenic
986537784 5:8809654-8809676 TAAACAGTCAACCCCCAGAGTGG - Intergenic
987088676 5:14491617-14491639 TACCCAGGCCACACACAGAGTGG - Intronic
988682381 5:33496412-33496434 TCTCAAGACCATCCCCAGAGAGG - Intergenic
991972837 5:72157548-72157570 TCCCCAGTCAGTCCCCAGGGAGG - Intronic
992857286 5:80875496-80875518 TACCCCTGCCAGCCCCAGAGGGG - Intronic
992878856 5:81085074-81085096 CACCCAGTCTAACCCCCGAGTGG + Intronic
1000505831 5:162116612-162116634 TACAAAGTCCATCCCTATAGAGG - Intronic
1001233551 5:170010326-170010348 ATCCCAGTCCTTACCCAGAGTGG - Intronic
1001393046 5:171395782-171395804 TACCCATTCCATCCTCAAAAAGG - Intronic
1002775527 6:324847-324869 GACCCATTCCATCACCAGCGAGG + Intronic
1003614924 6:7646343-7646365 TACACAGAACATCCCCAGAAGGG - Intergenic
1007660019 6:43478210-43478232 GCCCCAGTCCAACCCCAGAGCGG + Exonic
1008742020 6:54620717-54620739 TACCCAATCCACCACAAGAGGGG - Intergenic
1013242036 6:108255156-108255178 TATCTAATCCATCCCCAGAATGG - Intronic
1015710119 6:136130157-136130179 GACCCAGTCCATTACCAGAAAGG + Intronic
1016838705 6:148504951-148504973 TCCCCAGTACTTCCCCTGAGCGG - Intronic
1018635805 6:165858343-165858365 TTCCCAGTGCCTCCCCTGAGGGG - Intronic
1018935512 6:168271569-168271591 TTCCCAGTCCTTCCACTGAGAGG + Intergenic
1019351292 7:555209-555231 TCCTCAGCCCCTCCCCAGAGCGG - Intronic
1021920037 7:25475760-25475782 TCCCCCCTCCATCCCCAAAGGGG - Intergenic
1024238363 7:47414948-47414970 GACCCAGTCAATCGCCAGGGAGG + Intronic
1024274242 7:47664973-47664995 TGCCCAGTCCATAGTCAGAGAGG - Intergenic
1025128986 7:56365926-56365948 TACCCCTTCTTTCCCCAGAGGGG + Intergenic
1029189838 7:98763905-98763927 TATCCAGGCCATACCCAGGGCGG + Intergenic
1029521035 7:101062518-101062540 AACCCAGTTTATCCCAAGAGTGG - Intergenic
1035362564 7:158323037-158323059 TACCCAGCCCATGCACAGACAGG + Intronic
1035836853 8:2764055-2764077 TACCCATTCCTTCCCCACTGTGG - Intergenic
1039466663 8:37789438-37789460 TAGCCATTACATCCACAGAGAGG + Intronic
1040564468 8:48553400-48553422 GACCCTGTCCACCCCCAGTGAGG - Intergenic
1044259219 8:90098306-90098328 TGGCCAGTCCGTCACCAGAGTGG - Intergenic
1045535351 8:103021979-103022001 CACCCGTTCCATTCCCAGAGCGG - Intronic
1046055267 8:109071240-109071262 AGCCCAGGCCAGCCCCAGAGAGG + Intergenic
1048398062 8:134033831-134033853 TACCCATTCCACCCTCACAGTGG + Intergenic
1049225683 8:141449471-141449493 CACCCAGTCCAGCCCCAGCCTGG - Intergenic
1053108653 9:35437662-35437684 TTCCCAGTCTACCCCTAGAGAGG - Intergenic
1056703578 9:88932363-88932385 TGCCCTGGCCATCCCCAGAAAGG - Intergenic
1057967041 9:99514164-99514186 TACCCAGCCTCTCCCAAGAGAGG - Intergenic
1059824613 9:118014826-118014848 TAACCTGTCCATGCCCAAAGTGG + Intergenic
1061870194 9:133516327-133516349 TCCCCAGCCCCTCCCAAGAGGGG - Intronic
1061945985 9:133908385-133908407 CACCCTGTCCTTCCCCAGTGGGG + Intronic
1062066646 9:134531540-134531562 AACCCAGCCCCTCCCCGGAGTGG - Intergenic
1062236912 9:135514796-135514818 CACCCACTCCCACCCCAGAGAGG + Intergenic
1187469213 X:19553193-19553215 TACCAAGTCCATCCTAAGAGGGG - Intronic
1189944497 X:46164245-46164267 CCCCCAGTCCATCCCTAGAGGGG - Intergenic
1191629252 X:63303548-63303570 TACACAGACAACCCCCAGAGTGG - Intergenic
1196738943 X:119007226-119007248 TACCTAGTCCAATCCTAGAGGGG - Intronic
1200070965 X:153529131-153529153 ACCCCATTCCATCCCCAGAAGGG - Intronic
1202373035 Y:24210938-24210960 GAGCCAGCCCCTCCCCAGAGGGG + Intergenic
1202497747 Y:25459182-25459204 GAGCCAGCCCCTCCCCAGAGGGG - Intergenic