ID: 1089420513

View in Genome Browser
Species Human (GRCh38)
Location 11:118329949-118329971
Sequence TTTTGTTATAGCAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089420513_1089420519 24 Left 1089420513 11:118329949-118329971 CCATTCACCTTGCTATAACAAAA No data
Right 1089420519 11:118329996-118330018 CATTTATTTCTCAGTTCTGGAGG 0: 9
1: 30
2: 58
3: 133
4: 792
1089420513_1089420517 -8 Left 1089420513 11:118329949-118329971 CCATTCACCTTGCTATAACAAAA No data
Right 1089420517 11:118329964-118329986 TAACAAAAATACAGAATGGGTGG No data
1089420513_1089420520 28 Left 1089420513 11:118329949-118329971 CCATTCACCTTGCTATAACAAAA No data
Right 1089420520 11:118330000-118330022 TATTTCTCAGTTCTGGAGGCTGG 0: 19
1: 58
2: 344
3: 2572
4: 5965
1089420513_1089420521 29 Left 1089420513 11:118329949-118329971 CCATTCACCTTGCTATAACAAAA No data
Right 1089420521 11:118330001-118330023 ATTTCTCAGTTCTGGAGGCTGGG 0: 16
1: 40
2: 216
3: 1521
4: 3446
1089420513_1089420518 21 Left 1089420513 11:118329949-118329971 CCATTCACCTTGCTATAACAAAA No data
Right 1089420518 11:118329993-118330015 CAACATTTATTTCTCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089420513 Original CRISPR TTTTGTTATAGCAAGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr