ID: 1089424980

View in Genome Browser
Species Human (GRCh38)
Location 11:118365473-118365495
Sequence GAAAACAGCCTGACAGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089424980 Original CRISPR GAAAACAGCCTGACAGCTTT GGG (reversed) Intronic
902385981 1:16076232-16076254 GCTGGCAGCCTGACAGCTTTGGG + Intergenic
908610369 1:65852035-65852057 GAAATCAGCCTTACATCTCTAGG + Intronic
911672533 1:100623016-100623038 GAATACAGCCTCACATATTTAGG - Intergenic
912623621 1:111190179-111190201 AAAAACTACCTCACAGCTTTGGG + Intronic
915793275 1:158698804-158698826 GAAATCACACTGACAGCTATAGG + Intergenic
918369761 1:183847662-183847684 GAGAACCTGCTGACAGCTTTTGG + Exonic
919018911 1:192077808-192077830 GATATCTGCCTGAAAGCTTTCGG - Intergenic
922217433 1:223531795-223531817 GAAAAGTGCCTGACACCTTGTGG + Intergenic
922935794 1:229421276-229421298 GAAATCATCATGACAGCTTCCGG - Intergenic
1068172436 10:53412731-53412753 TAAAATAGCCTGAATGCTTTTGG + Intergenic
1070057636 10:72950949-72950971 GACAACAGCCTCTCAGCTTCCGG - Intronic
1070833286 10:79433150-79433172 GAAAGCAACCTGTCAGATTTGGG + Intronic
1072293961 10:93992649-93992671 GAAAACAGCAAGACAGTTTAAGG + Intergenic
1074513952 10:114147504-114147526 TAAAACAGCATGACACATTTAGG + Intronic
1074667640 10:115748247-115748269 TAAAACAGCCTGGAAGCTTCAGG - Intronic
1075884050 10:125881726-125881748 GAAAACAGCCTGGGAGGTTGAGG - Intronic
1076257931 10:129043175-129043197 GCAAACAGCTTGCAAGCTTTCGG + Intergenic
1076814326 10:132907179-132907201 GAAAACATCGTTACAGCCTTTGG + Intronic
1080660342 11:34291179-34291201 CATAACAGCCTGATAACTTTGGG + Intronic
1081831153 11:46116326-46116348 GAAACAAGCTTGAAAGCTTTAGG + Intronic
1086913556 11:92501031-92501053 GAAAATTGGATGACAGCTTTTGG + Intronic
1087065306 11:94022293-94022315 GAAAATAGCATGACATCTTCTGG - Intronic
1087222715 11:95563882-95563904 GTGGACAGCCTGAGAGCTTTTGG + Intergenic
1088608681 11:111556381-111556403 GATAGCAGCCTGACCTCTTTTGG - Intronic
1089141588 11:116289058-116289080 GAAAGAAGCCTGACAGCTGCAGG + Intergenic
1089284085 11:117394579-117394601 GGATGCAGCCTGACAGCTTCTGG + Intronic
1089424980 11:118365473-118365495 GAAAACAGCCTGACAGCTTTGGG - Intronic
1090844054 11:130516447-130516469 GCACTCAGCCTGACAGCCTTAGG - Intergenic
1091668915 12:2438568-2438590 GGAAACAGCCTGCCTGGTTTGGG + Intronic
1092102948 12:5901252-5901274 GGAAGCAGCCAGACAGCATTTGG + Intronic
1098152147 12:67557706-67557728 GAAAACAGACTGATAACTATGGG - Intergenic
1100077741 12:90807080-90807102 GAAAACAGCCTGGAATCATTAGG - Intergenic
1100169667 12:91959806-91959828 GAAAAAAGCCTCCCATCTTTGGG - Intergenic
1100343688 12:93706251-93706273 GAAAACACCCTGAAAGCTAAGGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102107374 12:110336946-110336968 GAAAACAGCTTCACAGATTGAGG + Intronic
1102206005 12:111091305-111091327 AAATACACCCTGGCAGCTTTGGG - Intronic
1103584897 12:121945287-121945309 AAAAACAGTCTGACTGCTGTGGG - Intronic
1105997945 13:25690754-25690776 GAAAACAGTCTTACAGTTTCTGG + Intronic
1107692627 13:42967390-42967412 GACAACAGCCTTATACCTTTAGG - Intronic
1108492673 13:50996904-50996926 GAACACAGCCTGACAGCTGCTGG - Intergenic
1110177957 13:72579878-72579900 GGAAACAGTCAAACAGCTTTAGG + Intergenic
1110320284 13:74153502-74153524 GAAAAAAGCATGACAGCTGGAGG - Intergenic
1110760313 13:79223780-79223802 GCAAACAGCCTGTGAGCTTGAGG - Intergenic
1112609315 13:100940408-100940430 GAAGACAGGCTGAAAGATTTAGG - Intergenic
1114846528 14:26329664-26329686 GAAAACAGTTTGCCACCTTTTGG - Intergenic
1115388465 14:32825517-32825539 GAAATCAGCCTGTCACCTTCAGG - Intronic
1116757536 14:48966315-48966337 GAAAGCCGCCAGACAGCTCTGGG - Intergenic
1117054360 14:51896543-51896565 GAAAGAAGCCTAAGAGCTTTGGG + Intronic
1117466566 14:56000285-56000307 TAAAATAGCCTGACCCCTTTGGG + Intergenic
1119550923 14:75513566-75513588 GAAAACGGCCTCTTAGCTTTGGG - Intergenic
1119909586 14:78337475-78337497 GAAAACAGCTAACCAGCTTTGGG + Intronic
1124108835 15:26767597-26767619 AAAAAAAGCCTTACAGCATTGGG - Intronic
1125647281 15:41283254-41283276 GTAAACAGCCGGACAACGTTTGG + Intergenic
1126361538 15:47851631-47851653 GAAATTAGCCTGACTGTTTTTGG + Intergenic
1128507883 15:68290038-68290060 GACATCAGCTTTACAGCTTTCGG - Exonic
1128921304 15:71612514-71612536 GAAAACAGCCTAACAGTGTTAGG - Intronic
1133603575 16:7364036-7364058 TAGAACAGCCAGTCAGCTTTGGG + Intronic
1135187372 16:20327002-20327024 CAAAAAAGCCTGCCAGCATTTGG + Intronic
1140338268 16:74132208-74132230 GAAAACAGCCAGAATGCTTCTGG + Intergenic
1143975732 17:10828241-10828263 GAGAACAGCCAGAGAGCTTGAGG - Intronic
1145769762 17:27484712-27484734 GGAAACAGCCTGCCTGCCTTGGG + Intronic
1150813160 17:68372697-68372719 GAAAACAGCCTGATACGGTTTGG - Intronic
1151132203 17:71908828-71908850 GCATACTGCCTGACAGTTTTAGG + Intergenic
1152167906 17:78722893-78722915 GAAAACAGCGGGACAGATTCAGG - Intronic
1152557436 17:81060602-81060624 GAAAACAGGCTCACAGCTGCCGG - Intronic
1154309031 18:13253494-13253516 TAAATCAGCCTGAGAGCTCTTGG - Intronic
1154322636 18:13367444-13367466 GAAAAGAGCCTGGCAGGTTTTGG + Intronic
1155046243 18:22105921-22105943 GAAAAAAGCCTGACAGACTAGGG - Intergenic
1156545208 18:37957280-37957302 GAACATATCCTGACACCTTTGGG - Intergenic
1158342729 18:56484275-56484297 GAAAAAAGCCTGCCAACATTAGG + Intergenic
1158539539 18:58340335-58340357 GAACACAGCTTGGCAGTTTTTGG - Intronic
1161330580 19:3685153-3685175 GAAACCAGCCTGCCAGCAATGGG + Intronic
1162173957 19:8815841-8815863 GAACAGAGCCTGAGACCTTTGGG + Intronic
1162812594 19:13173227-13173249 AAAGACAGCCTGTCAGCTTTGGG + Intergenic
1164661159 19:29969677-29969699 GAAAACATCCTGACTGTTCTTGG + Intronic
1164829990 19:31313071-31313093 TCAAACAGCATGACAGGTTTGGG + Intronic
1166672560 19:44719629-44719651 GAATAAAGCCAGACAACTTTGGG - Intergenic
1166988788 19:46678286-46678308 GGAAACAGCCTGGCACCTTGGGG - Intronic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
925157884 2:1661260-1661282 GAACAGAGCTTGACAGCTTGAGG + Intronic
925987008 2:9224878-9224900 GCAAGGAGCCTGACAGCTGTGGG - Intronic
928035180 2:27816021-27816043 GACTACCGCCTGACAGCTTAGGG - Intronic
929480671 2:42304458-42304480 GAAAAGAGACAGACAGCTGTTGG - Intronic
931616387 2:64162958-64162980 GATAACAGTCTGACAATTTTAGG + Intergenic
933132355 2:78688269-78688291 GAAAAGATCCTGAGAGCTTAGGG + Intergenic
935633465 2:105231656-105231678 GCACACAGCATGCCAGCTTTTGG - Intergenic
937248381 2:120508763-120508785 GAAAACAGCCTTGCAGCTCGGGG - Intergenic
941318211 2:164021481-164021503 GATAACATGCTGGCAGCTTTAGG - Intergenic
943035383 2:182738523-182738545 AAAAAAAACCTGACTGCTTTTGG - Intronic
943165891 2:184325310-184325332 GACAACAGTCTGATAGGTTTAGG - Intergenic
943852851 2:192749769-192749791 GAAAACAGAGTGACATCTATTGG - Intergenic
944409964 2:199430395-199430417 GCAAAGGGCCTGCCAGCTTTCGG + Intronic
944985484 2:205170724-205170746 GAAACCAACCAGACAGCTTTGGG - Intronic
945132746 2:206591710-206591732 GAAAACAGTCTGACATTATTTGG - Intronic
945959202 2:216114608-216114630 GATGATAACCTGACAGCTTTGGG - Intronic
946143000 2:217707274-217707296 CAAAACAGCCTCACAGCTCCAGG + Intronic
947532764 2:230923284-230923306 GATAACAGCCTGGCAGCTGCAGG - Intronic
1170998562 20:21391247-21391269 GGAAACAGCCTGACTACTCTGGG + Intergenic
1173998132 20:47355497-47355519 GAGAACAGGCTGGCAGATTTGGG + Intronic
1175175893 20:57111961-57111983 CAAAACAGCATGACATCTTCAGG + Intergenic
1175454703 20:59103417-59103439 GAAAGCAGACTGACATGTTTGGG + Intergenic
1176386179 21:6139532-6139554 GTAAACAGGAAGACAGCTTTCGG - Intergenic
1176931596 21:14818277-14818299 GCAAAGAGCCTTATAGCTTTTGG - Intergenic
1178396775 21:32249907-32249929 GAAAACACCCTGATATATTTTGG - Intergenic
1179737294 21:43398720-43398742 GTAAACAGGAAGACAGCTTTCGG + Intergenic
1183023616 22:35047270-35047292 GTAAACAGCATGCCAGCTTATGG + Intergenic
949408782 3:3741732-3741754 CAACACAGACTGACAGCTTTTGG - Intronic
950565014 3:13764150-13764172 GAAAAGAGTCTGACAGCTGCAGG + Intergenic
951784886 3:26406663-26406685 GAAAACAGCCTGACATTTTAGGG - Intergenic
952186271 3:30972851-30972873 CAAAACAGGCTGCCAGTTTTAGG + Intergenic
952964160 3:38610720-38610742 GAACACAGCCTCTCAGCTATGGG - Intronic
956596083 3:70968977-70968999 GAAAACGGCAGGACAGTTTTGGG + Intronic
957460960 3:80519946-80519968 GAATTCAGCCTGGCATCTTTAGG - Intergenic
957817751 3:85324355-85324377 GGAAACAGCCTAAGAGCTTTGGG - Intronic
959824629 3:110779004-110779026 GGAAACAGCCTGCCATGTTTAGG + Intergenic
960998718 3:123357908-123357930 GAAGAGAGCCTGGCAGCATTTGG - Intronic
963555520 3:146782731-146782753 TAAAATAGCCTTACAGTTTTAGG + Intergenic
964815102 3:160708996-160709018 GAAAAAAACCTGAGAGATTTGGG - Intergenic
967261089 3:187643142-187643164 CAAAGCAGCCTGACAGCTAAAGG + Intergenic
969938931 4:10710945-10710967 GGAAACATGCTTACAGCTTTGGG - Intergenic
973129031 4:46626335-46626357 GAAAATAGCCTGTTAGGTTTTGG - Intergenic
974028844 4:56757640-56757662 TAAAACAACCTGACAGCTACGGG + Intergenic
978356092 4:107876093-107876115 TAATACAGCCTGAGAGGTTTAGG - Intronic
983732116 4:171008613-171008635 GAAAACAGCCAGTGAGCTTGAGG + Intergenic
988437019 5:31188335-31188357 TAAAAGGGCCTGACAGCTTTAGG - Intergenic
988626003 5:32875339-32875361 GAAAGCAGCCTGCCAGTCTTGGG - Intergenic
989003511 5:36784997-36785019 GAAAACAGACTAACACATTTAGG - Intergenic
991212469 5:64121697-64121719 GAAAACAGACTGAGACTTTTGGG + Intergenic
993252437 5:85546417-85546439 GTACACAGGCAGACAGCTTTAGG + Intergenic
996369903 5:122742165-122742187 GAAAACAGCCTTACAGAGTCTGG - Intergenic
998582977 5:143400473-143400495 GGAAACAGACTTAAAGCTTTTGG - Exonic
1002534901 5:179870643-179870665 GATGACAGCCTGAGAGCTTTCGG - Intronic
1004564961 6:16787647-16787669 GAAAGCAGCCAGAGAGGTTTAGG + Intergenic
1007133194 6:39496069-39496091 AAAAACAGGCTGGCAGCTTGAGG - Intronic
1008450759 6:51647735-51647757 GAAAAGTGCCTGGCATCTTTGGG - Intronic
1008514451 6:52306520-52306542 GAAGACAGTTTGAGAGCTTTAGG + Intergenic
1009642666 6:66358512-66358534 GAAAACAGCCTGTCATTATTGGG - Intergenic
1010465790 6:76165913-76165935 GAAAACAGTCTGGTCGCTTTTGG - Intergenic
1010703411 6:79078144-79078166 GAACACACACTGACAGCTATAGG - Exonic
1011826877 6:91318307-91318329 GAGAACAGTGTGACAGCTTGTGG + Intergenic
1014456663 6:121643222-121643244 AAAAACAGCCTAATAACTTTTGG - Intergenic
1017401724 6:154072014-154072036 AAAAAGTCCCTGACAGCTTTTGG - Intronic
1018655026 6:166026513-166026535 GAAAAGAGCCAGAGAGCTGTGGG + Intergenic
1026259172 7:68739301-68739323 GAAGTCAGCCTGATAGCTTCTGG - Intergenic
1031519501 7:122746415-122746437 GAAAACAGACTGAGAGGTTAAGG + Intronic
1032206167 7:129867790-129867812 AAAAACATCCTGACTGCATTTGG + Intronic
1035530007 8:343922-343944 GATAACTGCCTGACAGCGCTCGG - Intergenic
1035623183 8:1050732-1050754 GAAAACAGCCAGGCAGTTTAAGG - Intergenic
1035750916 8:1995629-1995651 GAAAACAGGCCCACAGCTTCTGG - Intronic
1036049658 8:5182558-5182580 GAAAACAGGTTGGCAGGTTTTGG - Intergenic
1036186104 8:6623739-6623761 GTAAACAGCCTCTTAGCTTTTGG - Intronic
1037600078 8:20386527-20386549 GAAAACAGCCTGCATCCTTTGGG + Intergenic
1037732872 8:21543110-21543132 GATTCCAGCCTAACAGCTTTGGG - Intergenic
1038184883 8:25264161-25264183 GAGACCAGCCTGACAGCATGGGG + Intronic
1039599098 8:38819096-38819118 AAGCACAGCCTGACAGCTTCAGG - Intronic
1043246249 8:78005769-78005791 GAGAACAGCCACACAGCATTGGG - Intergenic
1046393045 8:113602041-113602063 GAAAACAGCCTGGCAATTTATGG - Intronic
1048104469 8:131392710-131392732 GGAAACAGCATGACACCTTGGGG - Intergenic
1051707408 9:19895366-19895388 AGAAACATCTTGACAGCTTTGGG - Intergenic
1053554488 9:39121554-39121576 GAAAACAGCATCACAGCTAATGG + Intronic
1055761176 9:79610099-79610121 AATAACAGACAGACAGCTTTAGG - Intronic
1058770636 9:108227879-108227901 GAAAACTGCTGCACAGCTTTAGG - Intergenic
1059957177 9:119529374-119529396 GCAAACAGCTAGACCGCTTTGGG + Intergenic
1060040445 9:120295830-120295852 GAAATCAGCCTGACAGGGCTGGG - Intergenic
1060472603 9:123961032-123961054 GAAAACATCCTGGAAGCTTCAGG - Intergenic
1061084055 9:128389179-128389201 GAAGAGAGGCTGAGAGCTTTGGG - Intronic
1185787895 X:2906045-2906067 GAAAAGAGCCTGCTAGCCTTGGG + Exonic
1186287697 X:8063438-8063460 GAAAAAATCCTCAGAGCTTTTGG + Intergenic
1186911959 X:14177295-14177317 GAAATGAGCCTGGCAGCATTTGG - Intergenic
1187097427 X:16162876-16162898 GCAAAGAGACTGACAGCATTTGG - Intergenic
1190088952 X:47420900-47420922 GAAAACAGCCTGAAGGCCTGGGG - Intergenic
1193404220 X:81082447-81082469 GAAAACAGACTCAGTGCTTTTGG + Intergenic
1193786040 X:85760689-85760711 GAAAACAGACTGAGGGCTGTTGG - Intergenic
1197133402 X:123032222-123032244 GAAGAGAGCCTGACTACTTTGGG - Intergenic
1198568127 X:137926281-137926303 GAAAACTGCCTGCCATCTTGTGG + Intergenic
1198939416 X:141936499-141936521 AAAAACAGCCTTAAAGATTTTGG + Intergenic
1199275117 X:145932095-145932117 TAAAACAGATTGTCAGCTTTCGG - Intergenic
1199665542 X:150093897-150093919 GAAAACAGAATGACAACATTAGG - Intergenic
1201287099 Y:12388512-12388534 GAAAAGAGCCTGCTAGCCTTGGG - Intergenic