ID: 1089426989

View in Genome Browser
Species Human (GRCh38)
Location 11:118385934-118385956
Sequence AACAAGTTGTTTGCTACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089426989 Original CRISPR AACAAGTTGTTTGCTACAAC AGG Intronic
904367003 1:30018845-30018867 AGCATATTGTTTGCTTCAACTGG + Intergenic
909836801 1:80265447-80265469 ATCATGTTCTTTGCTTCAACAGG + Intergenic
912940350 1:114039350-114039372 TACAAGCTGTTTGCTCCACCTGG - Intergenic
916287163 1:163120915-163120937 AACATGTTCTTTGCAGCAACAGG + Intronic
916947879 1:169747321-169747343 CACAATTTGTTTGATACAAGAGG + Intronic
917046137 1:170862662-170862684 AACAACTTTATTGTTACAACTGG - Intergenic
917332727 1:173898730-173898752 AATAAATTGAGTGCTACAACTGG - Exonic
924389707 1:243540245-243540267 AACAAGTGGTTTTTTTCAACAGG + Intronic
1070132810 10:73666570-73666592 AACAAGTTGTTTTCCAGAATTGG - Intergenic
1072773057 10:98159523-98159545 AACAAGATGTTTACAACAAATGG - Intronic
1074404014 10:113165340-113165362 AATAAGTTGTTTGCCAGAGCAGG + Intronic
1074676022 10:115852163-115852185 AAGAAGCTATGTGCTACAACTGG + Intronic
1080362436 11:31531604-31531626 AACAAGTAGTTTGCTATCCCTGG + Intronic
1080563171 11:33483264-33483286 AACAAGATATTTGTTACTACTGG - Intergenic
1082176599 11:49067138-49067160 ATCAAGTTGTTTCCAACAAAGGG + Intergenic
1086525657 11:87722957-87722979 GGCAAGTTGATTGCCACAACCGG - Intergenic
1086689110 11:89768738-89768760 ATCAAGTTGTTTCCAACAAAGGG - Intergenic
1086716748 11:90071222-90071244 ATCAAGTTGTTTCCAACAAAGGG + Intergenic
1088842085 11:113635675-113635697 AATAAATTCTTTGCTAAAACTGG - Intergenic
1089426989 11:118385934-118385956 AACAAGTTGTTTGCTACAACAGG + Intronic
1093237072 12:16623111-16623133 AACACGTTGTGTGATACAAATGG + Intergenic
1098647042 12:72916036-72916058 TACCATTTATTTGCTACAACTGG + Intergenic
1099253085 12:80282627-80282649 ATAAAATTGTTTGCTAAAACAGG - Intronic
1101850506 12:108398184-108398206 AACAGCTGGGTTGCTACAACTGG + Intergenic
1101911469 12:108863158-108863180 TACAAGTTATTTGCTTTAACAGG - Intronic
1102188998 12:110971831-110971853 CACCAGATGATTGCTACAACTGG + Intergenic
1104510921 12:129377049-129377071 AAGAGTTTGTTTGCTAAAACAGG - Intronic
1109192095 13:59337774-59337796 AAAAAGTTGTATGCTAGAATTGG + Intergenic
1119781899 14:77281514-77281536 AACCAGGTCTTTGCTAAAACAGG + Intronic
1120315162 14:82882916-82882938 AGCAAGTTGTTTGATATAAATGG - Intergenic
1120778344 14:88461943-88461965 AACAAGTTTATTTCTAGAACAGG - Intronic
1125378031 15:39054391-39054413 GACCAGTTGTTTGATAAAACTGG - Intergenic
1126665598 15:51073885-51073907 AAGAAATTGTTTGCTAAAATTGG - Intronic
1133590942 16:7242758-7242780 AACTAGTTGTCTGCAAGAACTGG + Intronic
1134881205 16:17746724-17746746 AACAAGCTGCTTCCTCCAACTGG - Intergenic
1137895933 16:52212515-52212537 AACACGTTGTTTTCAACAACTGG + Intergenic
1142779568 17:2170530-2170552 AACAAGTTGTTTTATACATGTGG - Intronic
1142834961 17:2578426-2578448 AACAAGTTGATTTCTGCAAATGG + Intergenic
1144587236 17:16494483-16494505 AACAGGGTCTTTGCTAAAACTGG + Intergenic
1149794544 17:59507255-59507277 AATAAGTTGTTGGCCACAACCGG + Intergenic
1151855958 17:76722072-76722094 AACAAGTTGTTTGCAATCCCTGG - Intronic
1153597295 18:6740794-6740816 AACAATGTCTGTGCTACAACTGG + Intronic
1158526651 18:58220672-58220694 AGTTAGCTGTTTGCTACAACTGG + Intronic
1158664967 18:59424024-59424046 AACAAGTTGATAGCTGCTACAGG - Intergenic
1158687402 18:59626988-59627010 AACTAGTTGATCTCTACAACAGG - Intronic
1159438588 18:68448784-68448806 AAAAAGTCATTTGCAACAACAGG - Intergenic
1159769236 18:72528504-72528526 AACAGGAGTTTTGCTACAACTGG + Intergenic
1163253096 19:16138420-16138442 ACCAAGTTCTTTCCTACCACAGG + Intronic
1164732039 19:30513745-30513767 AACAAGTTGGTTGTGACCACCGG - Intronic
927119928 2:19949229-19949251 TTCAAGTTGTTTGCCACAGCTGG + Intronic
927389303 2:22575361-22575383 AATAAGTTGGTTGTTACAAGTGG - Intergenic
931371183 2:61664532-61664554 AACATGTTGTTTTATACCACAGG + Intergenic
934516209 2:94988453-94988475 AACAGTTTGTATCCTACAACTGG - Intergenic
936669230 2:114637094-114637116 AACAAGATATTTGTTACAAATGG + Intronic
938151273 2:128886155-128886177 AACAAGTTGTTTTTGACAAGGGG - Intergenic
944293845 2:198039920-198039942 AACATGTTATTTGCTAGAATGGG + Intronic
1178202140 21:30419337-30419359 ATCAAGTTCTTTGCAACATCAGG + Intronic
957709144 3:83831550-83831572 AACATGTTGTATGATACAAAAGG + Intergenic
958034642 3:88155210-88155232 AACAGGTTATTTTCTATAACTGG - Intronic
964981392 3:162685927-162685949 AAAAAGATTTTTGCTATAACAGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
967632495 3:191761737-191761759 AAAAATGTGTTTGCTATAACTGG + Intergenic
970946428 4:21698198-21698220 AACAAGCTGTTTCTTAAAACTGG + Intronic
971246503 4:24933896-24933918 AACAAGTGGTTGACTCCAACTGG - Intronic
972032929 4:34485236-34485258 ATCAAATTGTTTGCTACATCTGG + Intergenic
975543985 4:75543320-75543342 CACAAGTGGTTTGCTAAAACTGG - Intronic
977184369 4:93917996-93918018 AACATCTTGTTTGCTAAAATTGG + Intergenic
977993677 4:103476390-103476412 AGCAAGGTATTTGCTAAAACTGG + Intergenic
978811759 4:112857076-112857098 AGCAAGATTTTTGCTAAAACTGG + Intronic
980132161 4:128826920-128826942 AACAGGATTTTTGCTTCAACTGG - Intronic
986551394 5:8959797-8959819 AAGAAATTGCTAGCTACAACTGG - Intergenic
988602561 5:32653595-32653617 AACAGGTTCTTTGCTAAAACTGG - Intergenic
989480932 5:41929296-41929318 AACAAGTTTATTGTCACAACTGG - Intronic
989518893 5:42377675-42377697 AAGAATTTGTTTGTTAGAACTGG + Intergenic
991257806 5:64634318-64634340 AGCAAGTTCTTTGCTACACCTGG + Intergenic
992059829 5:73031925-73031947 AATGAATAGTTTGCTACAACTGG - Intronic
993614892 5:90098530-90098552 AACAAGATAAATGCTACAACAGG + Intergenic
999642131 5:153682457-153682479 AGCAAGTTCTTTGCCAAAACTGG - Intronic
1001966931 5:175916619-175916641 AAAAAGTTTTCTGCTACAAAAGG - Intergenic
1002250011 5:177922587-177922609 AAAAAGTTTTCTGCTACAAAAGG + Intergenic
1005858463 6:29882506-29882528 AACAAGTTTTTTTCAAAAACTGG - Intergenic
1008046432 6:46855973-46855995 AACAATTTGTTTGGTAAAACAGG - Exonic
1008063686 6:47025517-47025539 AACAACTTTTTGGCTAGAACTGG - Intronic
1011760597 6:90561075-90561097 AACAATTTGTTTTATATAACTGG + Intronic
1013870198 6:114748786-114748808 CACAAGTTGTTTCCTTCAAAAGG - Intergenic
1015996406 6:138999292-138999314 AGCATGTTCTTTGCTAAAACTGG - Intergenic
1017416685 6:154228366-154228388 AACAAGTTTTTTATTACATCAGG - Intronic
1020504456 7:8966410-8966432 AAAAAATTGTTGGCTACAAGAGG - Intergenic
1020945629 7:14601781-14601803 AACAAGTTATTTGCAACCAGAGG - Intronic
1021597475 7:22332579-22332601 AACAAGAGGTTTTCAACAACTGG + Intronic
1024364264 7:48503258-48503280 AACAATTTGTTTGGTAGAAATGG + Intronic
1037597676 8:20368032-20368054 AACAAGTGGTTTTCTCAAACAGG - Intergenic
1038952038 8:32425670-32425692 AACAAGTTTTTTCCTGCAAAGGG - Intronic
1043780187 8:84324238-84324260 AAACAGTTGGTTGATACAACAGG - Intronic
1045150615 8:99403039-99403061 AATAAGTAGTCTGCCACAACTGG - Intronic
1046080007 8:109360631-109360653 AACAAGGAGTTTACTAAAACAGG + Intergenic
1048384270 8:133897159-133897181 AGCAAATTGATTGCTACAAGAGG - Intergenic
1052136448 9:24918016-24918038 TACTAGTAGTTTGCTAAAACAGG - Intergenic
1053650973 9:40169567-40169589 AACAGTTTGTTTGGTAAAACAGG + Intergenic
1053901360 9:42798920-42798942 AACAGTTTGTTTGGTAAAACAGG + Intergenic
1054533607 9:66206636-66206658 AACAGTTTGTTTGGTAAAACAGG - Intergenic
1055075317 9:72208776-72208798 TATAAGTTGTTTGTCACAACAGG - Intronic
1057956115 9:99409388-99409410 ATCAAGTGGTTTTCTACTACTGG - Intergenic
1058993860 9:110280547-110280569 AATAAGTTCTTTCCTACCACAGG - Intergenic
1059906875 9:118996805-118996827 TACAAGTTGGTTGCAAAAACTGG + Intergenic
1061747137 9:132748777-132748799 CACAAGTTGTTTGCTAAATATGG + Intronic
1186690059 X:11965888-11965910 AAGAAGTTCTTTCCTACAAAGGG + Intergenic
1187221987 X:17336920-17336942 AACAAATTGTTCCCTACCACAGG - Intergenic
1192075336 X:67989721-67989743 AACAAATTGGTTTCTACAAAGGG + Intergenic
1195350143 X:103987775-103987797 ACCAGGTTGTTTCTTACAACAGG - Intergenic
1195351777 X:104003315-104003337 ACCAGGTTGTTTCTTACAACAGG + Intergenic
1195357301 X:104051064-104051086 ACCAGGTTGTTTCTTACAACAGG + Intergenic
1202112787 Y:21441673-21441695 AACAAAATGTTAGCTACAAGTGG + Intergenic