ID: 1089432972

View in Genome Browser
Species Human (GRCh38)
Location 11:118437549-118437571
Sequence GGGGAGGATCGGTCTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089432972_1089432980 -2 Left 1089432972 11:118437549-118437571 CCCCAAGCAGACCGATCCTCCCC 0: 1
1: 0
2: 1
3: 6
4: 175
Right 1089432980 11:118437570-118437592 CCCATCCCGCCCTACCCCACCGG 0: 1
1: 0
2: 2
3: 26
4: 268
1089432972_1089432983 0 Left 1089432972 11:118437549-118437571 CCCCAAGCAGACCGATCCTCCCC 0: 1
1: 0
2: 1
3: 6
4: 175
Right 1089432983 11:118437572-118437594 CATCCCGCCCTACCCCACCGGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1089432972_1089432982 -1 Left 1089432972 11:118437549-118437571 CCCCAAGCAGACCGATCCTCCCC 0: 1
1: 0
2: 1
3: 6
4: 175
Right 1089432982 11:118437571-118437593 CCATCCCGCCCTACCCCACCGGG 0: 1
1: 0
2: 3
3: 54
4: 304
1089432972_1089432992 27 Left 1089432972 11:118437549-118437571 CCCCAAGCAGACCGATCCTCCCC 0: 1
1: 0
2: 1
3: 6
4: 175
Right 1089432992 11:118437599-118437621 TCTCTCCTCTGCACCTTGCCTGG 0: 1
1: 0
2: 1
3: 44
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089432972 Original CRISPR GGGGAGGATCGGTCTGCTTG GGG (reversed) Intronic
902565015 1:17305674-17305696 GGGGAGGATGGGTCAGGTTCTGG - Intergenic
902702153 1:18179685-18179707 GGTGAGGAGGGGTCGGCTTGGGG + Intronic
906095801 1:43223151-43223173 GGGGAGGGTCCATCTGCGTGAGG - Intronic
909032889 1:70562351-70562373 GGGGAGGCTGGGTCCTCTTGAGG + Intergenic
910639178 1:89441436-89441458 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
912733526 1:112130291-112130313 GGGGAGGCTGGGTCTCTTTGAGG - Intergenic
915667870 1:157461117-157461139 GGGGAGGTTGGGTCCCCTTGAGG - Intergenic
917052429 1:170939335-170939357 AGGGAGGATTGCACTGCTTGGGG + Intronic
921774513 1:219081724-219081746 GGAGAGCATCCATCTGCTTGAGG - Intergenic
921775077 1:219088662-219088684 GGAGAGGATCTGTGTTCTTGTGG + Intergenic
923725630 1:236503099-236503121 GATGAGGATCTGTATGCTTGAGG + Intergenic
924449599 1:244165594-244165616 GGTGAGCATTGGTCAGCTTGGGG + Intergenic
924474731 1:244372966-244372988 GGAGAGGATAGGGCTGATTGAGG - Intronic
924840978 1:247709272-247709294 GGGGAGGCTCGGTCCCCTTGAGG - Intergenic
1066112948 10:32213271-32213293 GGGGAGAATCTATCTTCTTGAGG + Intergenic
1066543521 10:36475002-36475024 GGGGAGGCCAGGTCCGCTTGAGG + Intergenic
1069192517 10:65507833-65507855 GGGGAGGCTAGGTCCCCTTGAGG - Intergenic
1069998558 10:72358899-72358921 GTGGAGAAGCGGGCTGCTTGTGG + Intergenic
1070800144 10:79240330-79240352 GGGGTGGAGCGGGCTGCTTTGGG + Intronic
1071799444 10:89042614-89042636 GGAGAGGCTCCTTCTGCTTGAGG - Intergenic
1074590153 10:114805068-114805090 GGGGAGGCTAGGTCCTCTTGAGG + Intergenic
1075331950 10:121580423-121580445 GGGTTTGAACGGTCTGCTTGAGG + Intronic
1077105249 11:839370-839392 GGGGAGAACGGGTCTGCCTGAGG - Intronic
1079723303 11:23846609-23846631 GGACAGAATCTGTCTGCTTGGGG - Intergenic
1080966526 11:37219818-37219840 GGGGAGACTCCTTCTGCTTGAGG - Intergenic
1081802586 11:45870018-45870040 GGGGATGATCAGCCTCCTTGGGG - Intronic
1085048515 11:73367550-73367572 GGGGAGGATCTGTCAGCTTGGGG - Intronic
1085685748 11:78620703-78620725 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
1085708648 11:78809620-78809642 GGGGAGAAGCGGCCAGCTTGGGG + Intronic
1085747373 11:79126761-79126783 GGGGAGGCCAGCTCTGCTTGAGG + Intronic
1087410953 11:97789632-97789654 GGGGAGGCCCGGTCCCCTTGAGG - Intergenic
1088191881 11:107235984-107236006 GGGGAGGGTGGGTCCCCTTGAGG - Intergenic
1088461900 11:110092083-110092105 GGGCAGGATGAGTCTGCTTCTGG - Intergenic
1089432972 11:118437549-118437571 GGGGAGGATCGGTCTGCTTGGGG - Intronic
1091287655 11:134416907-134416929 CGGGAGGCTTGGTGTGCTTGAGG + Intergenic
1092093072 12:5820151-5820173 GGGGAGGTTGGGTCCCCTTGAGG + Intronic
1093021643 12:14209376-14209398 GTGGATGATTGGTCTCCTTGAGG + Intergenic
1093497547 12:19775499-19775521 GGGCAGGAATGGGCTGCTTGGGG + Intergenic
1099735582 12:86563556-86563578 GGGGAGGCTGGGTCCCCTTGAGG + Intronic
1101534886 12:105607586-105607608 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1103102305 12:118189097-118189119 GGAGAGGATAGGGCTGATTGTGG - Intronic
1103409474 12:120700463-120700485 GGGCAGGATGGGTATGCTTTGGG + Exonic
1103928608 12:124437338-124437360 GGGGAGGCTGGGTCTGCCAGAGG - Intronic
1108065279 13:46571244-46571266 AGGGAGGATGGGTCTGCATCAGG + Intronic
1109293020 13:60498660-60498682 GGGGAGGCTGGGTCCCCTTGAGG + Intronic
1112993699 13:105546025-105546047 TGGGAGGATGGATCTGCTTCAGG - Intergenic
1113329864 13:109317473-109317495 AGGCAGGAATGGTCTGCTTGGGG - Intergenic
1113939422 13:114010683-114010705 GGGGAGGAGGGGGCTGCATGGGG + Intronic
1114758471 14:25285348-25285370 GGGGAGGCCAGGTCTCCTTGAGG - Intergenic
1116413205 14:44649707-44649729 GGAGAGGCTCCTTCTGCTTGAGG + Intergenic
1117690288 14:58298980-58299002 GGTGAAGAGCGGGCTGCTTGGGG + Intronic
1118927152 14:70202371-70202393 GGGGAGGATCCTTTTGCTTAAGG + Intergenic
1120082235 14:80229025-80229047 GGGGAGGCTGGGTCCCCTTGAGG - Intronic
1122078186 14:99248864-99248886 GGGGAAGATCTGTCTGCTCAAGG + Intronic
1123009607 14:105341844-105341866 GGGCAGGATCTGTCTGCTACGGG + Intronic
1126660720 15:51030740-51030762 GGAGAGGCTCCTTCTGCTTGAGG - Intergenic
1128336864 15:66792310-66792332 TGGGAGTTTTGGTCTGCTTGGGG + Intergenic
1129961548 15:79691227-79691249 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1136685204 16:31989975-31989997 GGGGAGGAAAGTTCTGGTTGAGG + Intergenic
1136751218 16:32637788-32637810 GGGTAGGATCGGGGTGCTGGAGG + Intergenic
1136785815 16:32933510-32933532 GGGGAGGAAAGTTCTGGTTGAGG + Intergenic
1136883954 16:33920294-33920316 GGGGAGGAAAGTTCTGGTTGAGG - Intergenic
1138553011 16:57757494-57757516 GGGGAGGAACGGGCTGGTGGGGG - Intergenic
1141559756 16:84859519-84859541 GGGGAGGCTAGGTCCCCTTGAGG - Intronic
1203053352 16_KI270728v1_random:897043-897065 GGGTAGGATCGGGGTGCTGGAGG + Intergenic
1203088049 16_KI270728v1_random:1195172-1195194 GGGGAGGAAAGTTCTGGTTGAGG + Intergenic
1143249804 17:5514813-5514835 GGTGAGGATGGGTCTCCTTCAGG + Exonic
1147146147 17:38485656-38485678 GGGGAGGAAAGTTCTGGTTGAGG + Intronic
1148122723 17:45222178-45222200 TGGGAGGCGCGGGCTGCTTGGGG - Exonic
1149184378 17:53979814-53979836 GGGGAGACTCTTTCTGCTTGTGG - Intergenic
1149236203 17:54593729-54593751 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1150550241 17:66203426-66203448 AGGGAGAATCTGTGTGCTTGGGG + Intergenic
1151037820 17:70821693-70821715 GGGGAGGCTGGGTCTCCTTTAGG - Intergenic
1153131487 18:1859209-1859231 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1153217905 18:2837099-2837121 GGGGAGGTCGGGTCTCCTTGAGG - Intergenic
1156990490 18:43402184-43402206 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1157871174 18:51231397-51231419 GGGGAGGCTGGGTCCTCTTGAGG - Intergenic
1159937193 18:74378625-74378647 AGGGAGGACAGGTCTGCATGTGG - Intergenic
1160851584 19:1195395-1195417 GGGCAGGATCTGTGTGTTTGGGG + Intronic
1160852008 19:1197209-1197231 GGGCAGGATCTGTGTGTTTGGGG + Intronic
1161769924 19:6225570-6225592 GGGGAGCATCGGGCAGCATGGGG - Intronic
1167930341 19:52858157-52858179 CGGGAGGATCGCTCAGCCTGGGG + Intergenic
1168354051 19:55691364-55691386 AGGGAGGATCGAGCTGCTTCGGG + Intronic
929859725 2:45666475-45666497 GGGTAGGAACCTTCTGCTTGAGG + Intronic
930909954 2:56619375-56619397 GGGGAGGCTTGGTCTCCTTGAGG + Intergenic
931388166 2:61815899-61815921 TGGGAGGATTGGTTTGCTTTGGG - Intergenic
937006766 2:118523756-118523778 AGGGAGGTTGGGTCTCCTTGAGG + Intergenic
937236132 2:120432843-120432865 AGGGAGGCTGGGTCTGCATGTGG + Intergenic
937800128 2:126073260-126073282 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
940606119 2:155925844-155925866 GGGGAGGCTGGGTCGCCTTGAGG - Intergenic
943306124 2:186264813-186264835 GGGGAGGCCAGGTCTCCTTGAGG + Intergenic
944954935 2:204798219-204798241 GGAGAGAATCTGTATGCTTGAGG + Intronic
948789810 2:240371403-240371425 GGGCAGCAGCGGTCAGCTTGGGG + Intergenic
1171330255 20:24331151-24331173 GGGGAGGACAGGTCACCTTGAGG - Intergenic
1172276334 20:33681661-33681683 GGGGAAGATCAGTCTGGTTTTGG - Intronic
1174153874 20:48504435-48504457 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174154274 20:48506589-48506611 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174154594 20:48508259-48508281 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174155102 20:48511001-48511023 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174155507 20:48513158-48513180 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174155922 20:48515358-48515380 GGGGAGGAGAGGTCTTCTTCTGG - Intergenic
1174299334 20:49570117-49570139 GAGGTGGAGCAGTCTGCTTGGGG - Intergenic
1177363535 21:20104367-20104389 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
1179286091 21:39978437-39978459 GGGGAGGATAGGTCAGGGTGTGG + Intergenic
1179643255 21:42760666-42760688 GGAGAGGATCGGCCTGCCTGTGG - Intronic
1180591344 22:16939855-16939877 GGGGAGGCCGGGTCTCCTTGAGG - Intergenic
1183339891 22:37274270-37274292 GGGGAGGAGGGGGCTGCTGGTGG - Intergenic
951436983 3:22676447-22676469 GGAGAGGCTCCTTCTGCTTGAGG - Intergenic
952921058 3:38284198-38284220 GGAGAAGAGCTGTCTGCTTGAGG - Intronic
953897598 3:46813983-46814005 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
955813334 3:62815452-62815474 GGGCAGGATGGGTCTCCTGGGGG + Intronic
959197087 3:103198066-103198088 GGGGTTGATCTGTCTGGTTGGGG - Intergenic
964803991 3:160587115-160587137 GTGGAGAATCTGTGTGCTTGGGG + Intergenic
966150994 3:176867812-176867834 AGAGAGGATCTGTGTGCTTGCGG + Intergenic
967831565 3:193924499-193924521 GGGGAGGCCGGGTCTCCTTGAGG + Intergenic
968906673 4:3456153-3456175 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
971954299 4:33396042-33396064 GGAGAGAATCCTTCTGCTTGAGG + Intergenic
972201497 4:36718639-36718661 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
977490286 4:97701546-97701568 GGGGAGGCTGGGTCCCCTTGAGG - Intronic
981834789 4:149042448-149042470 GGGGAGGCTGGGTCCTCTTGAGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984692744 4:182746519-182746541 GGGGAGGGTCAGATTGCTTGGGG + Intronic
986086916 5:4461223-4461245 GGGGAGGCTGGGTCTTCTTGAGG + Intergenic
986742712 5:10718009-10718031 GGGGAGGCTGGGTCCCCTTGAGG + Intronic
987152969 5:15060176-15060198 GGGGAGGACTGGTCCCCTTGAGG + Intergenic
987886179 5:23815880-23815902 GGAGAGAATCTGTGTGCTTGGGG + Intergenic
988064755 5:26219397-26219419 GGAGAGGTTCCTTCTGCTTGAGG + Intergenic
989457854 5:41663260-41663282 GGGGAGGATGGGTCCCCTTGAGG - Intergenic
989486581 5:41997865-41997887 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
994541098 5:101098725-101098747 GGGGAGGCTCTATCTCCTTGTGG - Intergenic
994958263 5:106562841-106562863 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
995697912 5:114900413-114900435 GGAGAGAATCTGTGTGCTTGGGG - Intergenic
998920664 5:147064315-147064337 GGGGGAGATGGGTCTGTTTGAGG + Intronic
1001840924 5:174875996-174876018 GGGGAGAGTGGGTCTGCTTCTGG + Intergenic
1004824501 6:19404719-19404741 GGGGAGGCTAGGTCCCCTTGAGG - Intergenic
1006181131 6:32154109-32154131 GGGGAAGGGCGGGCTGCTTGGGG - Intronic
1007636590 6:43303516-43303538 GGGCAGGATGGGGCTTCTTGGGG - Intronic
1012820598 6:104081440-104081462 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
1013357328 6:109357774-109357796 CGGGAGGATGGATCTCCTTGAGG + Intergenic
1017228026 6:152042573-152042595 GGGGAGGCTGGGTCCCCTTGAGG - Intronic
1018654864 6:166025367-166025389 GGCGAGGATGGGTCAGCTTTTGG - Intergenic
1019126252 6:169842076-169842098 GGGGAGGATCGGTGTCTTTTAGG + Intergenic
1022078684 7:26998831-26998853 GGGGAGGCTGGGTCCTCTTGAGG + Intergenic
1022224378 7:28347920-28347942 GGGGAGGACTGGTGTCCTTGAGG + Intronic
1023938645 7:44756563-44756585 TGGGAGGCTCTGTCTGCTCGGGG - Intronic
1024986053 7:55194110-55194132 TGGGAGGGGCGGGCTGCTTGAGG - Intronic
1037714501 8:21385643-21385665 GGAGAGGAACACTCTGCTTGGGG + Intergenic
1040916343 8:52569325-52569347 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1041606821 8:59792011-59792033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1043134175 8:76500549-76500571 GGAGAGGCTCCTTCTGCTTGAGG - Intergenic
1043232663 8:77822407-77822429 GGGGAGGCTAGGTCCCCTTGAGG - Intergenic
1044124261 8:88438085-88438107 GGGGAGACTCCTTCTGCTTGAGG + Intergenic
1044633628 8:94301275-94301297 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1045826322 8:106402763-106402785 GGGGAAGTTGGGTCTCCTTGAGG - Intronic
1047456441 8:125017363-125017385 GGAGAGGCTCCTTCTGCTTGAGG - Intronic
1049598989 8:143498576-143498598 GGGGAGGACAGGGCTGCATGGGG - Intronic
1049660954 8:143819537-143819559 GGGGAGGTTCGGCCTGCATTAGG - Intronic
1049683650 8:143930699-143930721 AGGGTGCATGGGTCTGCTTGGGG - Intronic
1051130266 9:13852621-13852643 AGTGAGGATTGGTTTGCTTGAGG - Intergenic
1057227680 9:93301108-93301130 GGGAAGGCTCTGCCTGCTTGGGG + Intronic
1061326779 9:129869015-129869037 CGGGAGGGTGGGTCAGCTTGAGG + Intronic
1185972914 X:4684619-4684641 AAGGAGGATAGGGCTGCTTGTGG - Intergenic
1187575130 X:20546019-20546041 AGAGAGAATCTGTCTGCTTGGGG - Intergenic
1187942320 X:24394020-24394042 GGAGAAAATAGGTCTGCTTGGGG + Intergenic
1189384379 X:40525317-40525339 GTGGATGATTGGTCTACTTGAGG + Intergenic
1191134152 X:57045448-57045470 GAGGAGGCTGGGTCTTCTTGAGG - Intergenic
1192297913 X:69869496-69869518 GGGGAGGCTGGGTCCCCTTGAGG - Intronic
1192810357 X:74541928-74541950 GGGCAGGAAGGGTCTGTTTGGGG - Intergenic
1192996013 X:76514078-76514100 GGGGAGGCTGGGTCCGTTTGAGG + Intergenic
1193335578 X:80285011-80285033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1193573885 X:83176495-83176517 GGGGAGGCTAGGTCACCTTGAGG - Intergenic
1194849455 X:98853663-98853685 GGGGAGGCTGGGTCCCCTTGAGG - Intergenic
1195782570 X:108481363-108481385 GGGGAGGCTGGGTCCCCTTGAGG - Intronic
1196793149 X:119482191-119482213 AGGGACCATCGGCCTGCTTGGGG + Intergenic
1197002084 X:121451460-121451482 GGGGAGGTTGTGTCTCCTTGAGG + Intergenic
1197097267 X:122611345-122611367 GGGGAGGCTGGGTATCCTTGAGG + Intergenic
1198302081 X:135343206-135343228 GGGGAGGCTGGGCCTCCTTGAGG + Exonic
1198701088 X:139398797-139398819 GGGGAGGCTGGGTCCCCTTGAGG + Intergenic
1198933812 X:141886356-141886378 GGGGAGGCTGGGTCCCCTTGAGG + Intronic
1199874500 X:151920040-151920062 GGGGAGGATAGGGGTGCTGGTGG - Intronic
1200289301 X:154856681-154856703 GGGGAGGCTCAGTCTCCTTGAGG + Intronic
1200683966 Y:6244304-6244326 GGGGTGGACCTGTCTGCCTGAGG + Intergenic
1201048669 Y:9910082-9910104 GGGGTGGACCTGTCTGCCTGAGG - Intergenic