ID: 1089433169

View in Genome Browser
Species Human (GRCh38)
Location 11:118438404-118438426
Sequence CTCCCCCCTTCTGCATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 178}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089433169_1089433183 25 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433183 11:118438452-118438474 GCATGGGGGATGCTAGGAGGAGG 0: 1
1: 0
2: 3
3: 28
4: 276
1089433169_1089433179 10 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433179 11:118438437-118438459 AGAGGGGGGAGGATGGCATGGGG 0: 1
1: 0
2: 24
3: 548
4: 5152
1089433169_1089433181 19 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433181 11:118438446-118438468 AGGATGGCATGGGGGATGCTAGG 0: 1
1: 0
2: 1
3: 32
4: 325
1089433169_1089433177 8 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433177 11:118438435-118438457 GTAGAGGGGGGAGGATGGCATGG 0: 1
1: 0
2: 4
3: 66
4: 978
1089433169_1089433172 -6 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433172 11:118438421-118438443 GGGGAGTTCGAATTGTAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 62
1089433169_1089433178 9 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433178 11:118438436-118438458 TAGAGGGGGGAGGATGGCATGGG 0: 1
1: 0
2: 2
3: 63
4: 573
1089433169_1089433171 -7 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433171 11:118438420-118438442 GGGGGAGTTCGAATTGTAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1089433169_1089433170 -8 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433170 11:118438419-118438441 GGGGGGAGTTCGAATTGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1089433169_1089433174 -4 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433174 11:118438423-118438445 GGAGTTCGAATTGTAGAGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1089433169_1089433173 -5 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433173 11:118438422-118438444 GGGAGTTCGAATTGTAGAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 87
1089433169_1089433176 3 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433176 11:118438430-118438452 GAATTGTAGAGGGGGGAGGATGG 0: 1
1: 0
2: 1
3: 44
4: 568
1089433169_1089433182 22 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433182 11:118438449-118438471 ATGGCATGGGGGATGCTAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 190
1089433169_1089433175 -1 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433175 11:118438426-118438448 GTTCGAATTGTAGAGGGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 57
1089433169_1089433180 11 Left 1089433169 11:118438404-118438426 CCATTGGATGCAGAAGGGGGGAG 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1089433180 11:118438438-118438460 GAGGGGGGAGGATGGCATGGGGG 0: 1
1: 0
2: 11
3: 163
4: 1601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089433169 Original CRISPR CTCCCCCCTTCTGCATCCAA TGG (reversed) Intronic
900254951 1:1693138-1693160 CCCCCCCCTTCTGCCTTCAGTGG - Intronic
900263700 1:1746417-1746439 CCCCCCCCTTCTGCCTTCAGTGG - Intergenic
902665462 1:17934523-17934545 CAACCTCCTTCTGGATCCAAGGG + Intergenic
902816527 1:18919474-18919496 CTCCCCACTTCTGCTTCCCTCGG - Intronic
902823983 1:18960054-18960076 CTCCCCCATTCAAGATCCAAAGG + Intergenic
903968341 1:27103180-27103202 GTTCCTCCTTCTGCAACCAAGGG + Intronic
906566578 1:46805287-46805309 CTCCTGTCTTCAGCATCCAAAGG - Intronic
906677319 1:47702435-47702457 CTGCCCCATTCTGCAGGCAATGG + Intergenic
907560859 1:55386123-55386145 CTCCCCTCTGCTGCAGCCATGGG - Intergenic
908834183 1:68211985-68212007 CTCCCCCATTCTGATTACAAAGG + Intronic
909131480 1:71742364-71742386 CTCCCACTTTCTGCACCCACTGG - Intronic
910496423 1:87834194-87834216 CTCCCCCCTTATTCAGCCAGAGG + Intergenic
911282709 1:95951475-95951497 CTCCCCCCTTTGGCATCCGCAGG + Intergenic
916004828 1:160650021-160650043 CTTCCCCACTCTGCATTCAATGG + Intergenic
916200620 1:162267927-162267949 CTCCCACCTTCTGCAACAACTGG - Intronic
916578817 1:166089799-166089821 CTCCCTCCTACTGAGTCCAAGGG - Intronic
917207308 1:172590776-172590798 CTACCTCCATCTGCATCCCAAGG + Intronic
917814481 1:178693607-178693629 CTCCCCCTTTCTCCATCCAGGGG + Intergenic
921157382 1:212449187-212449209 CTCCCTCCTTCTTCATCCCAGGG - Intergenic
922216423 1:223523640-223523662 CTGCTCCCTGCTCCATCCAAAGG + Intergenic
922466023 1:225845970-225845992 CTCCTCCCTGCTGCCTCCAGGGG - Exonic
922719268 1:227892021-227892043 CTCCCCACTGCTGCAGCCCAAGG - Intergenic
923119538 1:230978189-230978211 CTCGCCCCTTCGGCATCCTCGGG + Intronic
924851910 1:247839394-247839416 CTCCTCCCTTCTGCATTGGAAGG + Intergenic
1062982263 10:1735723-1735745 CACCTCCCTTCTGAAACCAAAGG + Intronic
1065628609 10:27655187-27655209 CTCCCACCCTCAGCCTCCAATGG - Intergenic
1072729312 10:97834513-97834535 CTCCCTCCTTCTGCCTGCCATGG + Intergenic
1076585726 10:131546316-131546338 GTCCCCTCTTCAGCATCCATCGG + Intergenic
1077041919 11:528580-528602 CTCCCCGCGTCTGCATCCCCAGG + Intergenic
1077745194 11:4895677-4895699 CTCCCACCTTGTGCTACCAAAGG - Intronic
1078098160 11:8313050-8313072 CCCGCCCCATCTGCATCCACGGG + Intergenic
1078409993 11:11106687-11106709 CTCCCCCATTCTGTAACTAATGG - Intergenic
1078859970 11:15238008-15238030 CTCCCCTCTTCTGCACCCAGTGG - Intronic
1078882874 11:15469913-15469935 CTTCCCCACTCTGCATTCAACGG - Intergenic
1079138946 11:17794966-17794988 CTGCCCCCTTCTGCATCTGCTGG + Intronic
1079946528 11:26749533-26749555 ACCCCACCTTCTGCATCCCAAGG + Intergenic
1080272574 11:30466555-30466577 CTGCTCCCCTCTGCATCAAAGGG - Intronic
1081676380 11:44972341-44972363 CTCTCTCCTTCTGCAGCCAAAGG - Intergenic
1085018788 11:73192230-73192252 CTGCCCGCTTCTGCCTCCCAAGG + Intergenic
1087882941 11:103440270-103440292 CTCCCCCATTATGCTTCCATTGG + Intronic
1089297082 11:117476124-117476146 CTCTCCCTTTCTTCATCAAAGGG + Intronic
1089433169 11:118438404-118438426 CTCCCCCCTTCTGCATCCAATGG - Intronic
1090412367 11:126518115-126518137 CTCCCTCCTTCTGCCTCCCGAGG + Intronic
1090931940 11:131305516-131305538 ATCCCCACTTCTGCTTCCAGTGG + Intergenic
1091024257 11:132127908-132127930 ATCCACCCTTCCCCATCCAAGGG + Intronic
1092955821 12:13548803-13548825 CTCCCCCCATCTTCATGCATGGG + Exonic
1094253596 12:28395753-28395775 CTCATCCCTCCAGCATCCAATGG + Intronic
1096460547 12:51819530-51819552 CTCCCCCCCACTCCATCCAGGGG - Intergenic
1101252843 12:102952163-102952185 CTCCCCCCTTCACAATCGAAGGG - Intronic
1102893178 12:116577670-116577692 CTCCCACCATCTGTATACAAGGG + Intergenic
1103324334 12:120110496-120110518 CTGCCCGCTTCTGCCTCCCAAGG + Intronic
1105458988 13:20566789-20566811 CTCCTCCCTCCTGCATCTACTGG + Intergenic
1107103717 13:36621861-36621883 CTCCCTCTTTCTGGATCAAAAGG + Intergenic
1108573188 13:51769812-51769834 GTCCCACCCTCTGCATCCCAGGG + Intronic
1108648518 13:52453282-52453304 CTCCCACCTTCTGAATCAGATGG + Intergenic
1112329392 13:98465271-98465293 CTCCCTCCCTGTCCATCCAAGGG + Intronic
1116600530 14:46916266-46916288 CTCCGCCCCTCTTCATCCTATGG - Intronic
1117649045 14:57882981-57883003 CTCTCCCCTTATTCTTCCAAGGG - Intronic
1118330557 14:64812426-64812448 CACTCCCCTTTTGCATCCAGGGG - Intronic
1118727491 14:68639433-68639455 CTGGCCCCTCCTGCATGCAAGGG + Intronic
1118728005 14:68644079-68644101 CTCCTCCCTTCTTCTTCCAGGGG + Intronic
1126940709 15:53762268-53762290 CTCTCGCCTTCTGCATCCTTTGG + Intronic
1131816988 15:96232432-96232454 TTCCGCCCTGCTGCATACAAAGG + Intergenic
1132743667 16:1428070-1428092 CACCCCCCTCCAGCATCCAGAGG + Intergenic
1133484245 16:6203249-6203271 CTTCCCCCTTCTCCAACCCATGG + Intronic
1133717058 16:8459905-8459927 CTTCCACTTTCTGCATTCAATGG - Intergenic
1135740605 16:24972100-24972122 CTTGCCTCTTCTGCCTCCAAAGG + Intronic
1136005315 16:27325156-27325178 CTCCCCCTTGCTCCAGCCAAGGG + Intronic
1137573030 16:49579056-49579078 CTCCCACCCTCTGCATCCTGGGG - Intronic
1137711574 16:50570734-50570756 CTACCCCGTTCTGCCTCCAAAGG - Intronic
1138329085 16:56198810-56198832 CACCCCCCTTCTGCTTCTCAGGG - Intronic
1138461778 16:57153158-57153180 CTCCCTCCTCCAGAATCCAAGGG + Exonic
1141610259 16:85177163-85177185 CTTCCCCCTCCTGCTTCCAGGGG - Intronic
1144599384 17:16599154-16599176 CTCCTCCCCTCTGCAGCCATGGG + Intergenic
1145420810 17:22827363-22827385 TTCCAACCTTCTCCATCCAAAGG - Intergenic
1145423247 17:22860668-22860690 TTCCAACCTTCTCCATCCAAAGG - Intergenic
1145427715 17:22922524-22922546 TTCCAACCTTCTCCATCCAAAGG - Intergenic
1145434903 17:23021263-23021285 TTCACACCTTCTCCATCCAAAGG - Intergenic
1145872003 17:28281733-28281755 CTCCCTCCTTCTGAACCAAATGG + Intergenic
1146185271 17:30720359-30720381 CTCTCCCCATCTCCATCCCAGGG + Intergenic
1147664690 17:42139108-42139130 CTCCCTCTTTCTGCACCCACAGG + Intronic
1147759793 17:42790076-42790098 CTTCCCCCTTCCACATCCCATGG - Intronic
1148464681 17:47857801-47857823 CTCCCCTCTTCTGGCTCCAAAGG - Intergenic
1148806326 17:50265740-50265762 GACCCACCTTCTGCATCCAAAGG + Intergenic
1152392863 17:80013148-80013170 CTCAGCCCTGCTGCTTCCAAAGG - Intronic
1152526969 17:80893876-80893898 CTGCCCCTTTCTGCTTCCGAGGG + Intronic
1155368515 18:25073628-25073650 CTCCCTCCTTCTTCCTACAAAGG - Intronic
1160427223 18:78786974-78786996 CTCTCACCCTCTGCACCCAAGGG + Intergenic
1160579706 18:79876569-79876591 ATGCCCTCTTCTGCATCCACAGG + Intronic
1162700176 19:12509103-12509125 CACCTCCCTTCTGCACCCAGAGG - Intronic
1163130205 19:15267670-15267692 CTTCCCCGATCTGCACCCAAAGG + Intronic
1163267477 19:16229580-16229602 CTCTCTCCATCTGCATCCCAGGG + Intronic
1163466650 19:17471753-17471775 CTCACCCCTTCTGCATGCCATGG + Intronic
1164397622 19:27879755-27879777 GTCCCCCCATCTGCAGCTAAGGG - Intergenic
1166671339 19:44711177-44711199 CTCCTTCCTTCTGCAGCCACAGG + Intergenic
1167565045 19:50250741-50250763 CTCCCCCCATCTGTAGCCAGTGG - Intronic
1168639474 19:58021149-58021171 CTGCCCACTTCTGCCTCCCAAGG - Intergenic
925555431 2:5125990-5126012 CCCCCCCCTTCTCTCTCCAAGGG - Intergenic
925594177 2:5539073-5539095 GTCCCCCCTTCTGCATGAGATGG - Intergenic
927708693 2:25312336-25312358 CTCCTCCCTTCTGAATCCATGGG - Intronic
927772652 2:25877778-25877800 CTTCTCCTATCTGCATCCAATGG + Intronic
929491985 2:42405393-42405415 TTCACCCCTTCTGCATTCATTGG + Intronic
935580218 2:104750146-104750168 CTCCCCCCTTCAACCTCCACAGG - Intergenic
936616698 2:114055356-114055378 CTCCCTCCATCTGCATCCCTTGG + Intergenic
940807565 2:158205234-158205256 CTCCCCACTCCTACAGCCAAGGG - Intronic
943208945 2:184938052-184938074 CTCCTTCCTTCTGAAACCAATGG + Exonic
945296335 2:208174891-208174913 CTCCCTCTTTCTCCATCAAATGG + Intronic
947294433 2:228615209-228615231 CTCATCCCTTCTTCCTCCAAAGG + Intergenic
948577793 2:238965454-238965476 CTCCTCCCTCCTGCCTCCACCGG + Intergenic
948802258 2:240438261-240438283 CTCCCCACTTCTGCAGCCATAGG - Intronic
1169968749 20:11246401-11246423 CCCTCCCCTACTGCTTCCAAAGG - Intergenic
1170802338 20:19600902-19600924 CCCCCCACTTCTGCCTCCCAAGG + Intronic
1173387908 20:42605703-42605725 CTCCCCACAGCAGCATCCAATGG - Intronic
1174292257 20:49517585-49517607 TTCCCTCCTACTGCAGCCAAAGG + Intronic
1174627442 20:51927344-51927366 CCACCCCCTTCTGCCTCCCAAGG - Intergenic
1178578314 21:33814873-33814895 CTCGCCTCTTCTGCTTCCACCGG - Intronic
1179487973 21:41722870-41722892 CTCCCACTTCCGGCATCCAAGGG + Intergenic
1179714855 21:43281425-43281447 CTCACCCCATCTGCATCTATAGG + Intergenic
1180647225 22:17349309-17349331 CTTCCCCCTTGTCCACCCAAAGG + Intergenic
1181373752 22:22439972-22439994 CACCCACCTTCAGCATCAAAAGG - Intergenic
1181423630 22:22818941-22818963 CTCCCCCTCTCTGCATCCTTTGG + Intronic
1182623905 22:31632223-31632245 CTTCCCCCTGCCGCATCCCAGGG - Intronic
1184517555 22:44971967-44971989 CTCCCCCCAACTGCAACCCAGGG - Intronic
1184576861 22:45376224-45376246 CTCTCCCCTTCTACAGCCACTGG + Intronic
952943589 3:38460916-38460938 CTCCTCCATTCTCCAGCCAAGGG - Intronic
954377597 3:50203366-50203388 TTCCCCCATTCTCCATCCCAAGG + Intergenic
955082875 3:55674049-55674071 TTCCCAGCCTCTGCATCCAAAGG + Intronic
955320948 3:57973810-57973832 CTCCCACCCCCTGCATCCCAAGG - Intergenic
955841613 3:63118970-63118992 ATCTCCCCGTGTGCATCCAAGGG + Intergenic
957048527 3:75394780-75394802 CTCCTCCCTTCAGAGTCCAAGGG - Intergenic
960232118 3:115240748-115240770 CTAAACCCTTCTGCTTCCAAAGG + Intergenic
961630686 3:128296276-128296298 CTCACCCTTTCTGCATACCAGGG - Intronic
961642610 3:128374058-128374080 CTCCCCTCTGCAGCATGCAAGGG + Intronic
961664794 3:128488544-128488566 CTCCCCCTTTCTGGAGCCACCGG - Intronic
962651039 3:137491595-137491617 CTTACCCCTTCTCCATCAAAGGG + Intergenic
964767143 3:160190197-160190219 ATCCCCCCTTCTGCCTAGAAGGG - Intergenic
965910801 3:173772896-173772918 CACCTCGCTTTTGCATCCAAAGG + Intronic
970070067 4:12148187-12148209 ATCCCCCCTCCTCCATCCATGGG + Intergenic
970571946 4:17392107-17392129 CTCCCACCTTGAGCTTCCAAAGG - Intergenic
972271318 4:37512843-37512865 CTGCCCCCTTCGGCCTCCCAAGG - Intronic
975824038 4:78301089-78301111 ATCCTTCCTTCTGCCTCCAAAGG + Intronic
976099949 4:81550791-81550813 CTCCACCCCTCTGCTTCCATGGG - Intronic
976490026 4:85659820-85659842 CTCCCCTATTCTGGATCCAGGGG + Intronic
977423806 4:96839326-96839348 CCACCCCCTACTGCACCCAATGG + Intergenic
977954472 4:103011286-103011308 GTCCTGCCTTCTGCATACAATGG + Intronic
981920619 4:150080260-150080282 GTCCCCACTGCTGAATCCAATGG - Intronic
984729852 4:183057805-183057827 CTCCCATCCTCTGCACCCAAAGG + Intergenic
986221992 5:5776353-5776375 CTCCCTCCTCCTGCATCCCAGGG - Intergenic
986272554 5:6246488-6246510 CTCCCCACTTCTGGAACCAGAGG - Intergenic
986632030 5:9783042-9783064 CACGCCCCTTCTGCAGCCATGGG - Intergenic
989383140 5:40828899-40828921 CTCTCCACTTCTGTCTCCAATGG + Exonic
990031641 5:51267651-51267673 CTCCCCACTTCTGACTACAAAGG + Intergenic
992233656 5:74686241-74686263 CTCACCCTGTCTGCAGCCAAAGG - Intronic
996058841 5:119010485-119010507 CTCCCCCCTTCTGCATTACATGG + Intergenic
998003364 5:138641547-138641569 CTCCCCTCTTGTGCTTCCCATGG + Intronic
998137894 5:139684023-139684045 CTCCCCCATTCTGGATCCAGAGG - Intergenic
1000036051 5:157448835-157448857 TTCTCCCCTTCTGCATCATAAGG + Intronic
1000984750 5:167854942-167854964 CTCCCTGCTTCTGCATCCCTTGG + Intronic
1001253723 5:170167865-170167887 CTTCCCTCTTCTGTCTCCAAGGG - Intergenic
1002566462 5:180114898-180114920 CTACCCCCATCCCCATCCAAAGG + Intronic
1003009157 6:2410051-2410073 GCCCACCCTTCTGCATCCAAGGG - Intergenic
1004853020 6:19719820-19719842 CTCCCCCTTTCAGCGTGCAAAGG + Intergenic
1006885221 6:37376037-37376059 CTCCAGCCTTCTGCCTCCAGAGG + Intronic
1008265172 6:49416211-49416233 CCCCCACCTTCTTCATCCATAGG - Intergenic
1014365428 6:120534933-120534955 CTCACCCTTACTGCATCCAAGGG + Intergenic
1017751019 6:157490720-157490742 CTCCCCGCTTCTTCACCCACTGG - Intronic
1017969066 6:159294945-159294967 CTCTCTCCTTCTGCAGGCAATGG - Intergenic
1018859279 6:167699074-167699096 CTCCCCCCAGCTGCAGCCACAGG + Intergenic
1020115324 7:5473007-5473029 CTCTCCCCTGCTGCAGCCATTGG + Intronic
1021544787 7:21800894-21800916 CTCTCCCCTTCTGCCTCCACTGG - Intronic
1022478469 7:30727431-30727453 CTCCCTCCTCCTGCCTCCAGAGG - Intronic
1023216816 7:37871276-37871298 CCCCACCCTTCTGCAGCCACTGG - Intronic
1023562558 7:41491131-41491153 CTCCCTCCTCCTGAATCCAAAGG + Intergenic
1029423676 7:100484146-100484168 CATCCCCCTTCTCCATCCAAGGG - Intronic
1029853550 7:103489865-103489887 CTTCTCCCTTCTGGATCCAGCGG + Exonic
1031897542 7:127368773-127368795 CTCCCCACTACTGCATCCATAGG + Intronic
1033429437 7:141275543-141275565 CACCACCCTTCAGCATCCAGAGG + Intronic
1034449814 7:151131222-151131244 CTCCCCCATTTTGCAGCCAGCGG + Intronic
1035249977 7:157590765-157590787 CTCCCCCCTTCTGGACCCATGGG + Intronic
1036849993 8:12194456-12194478 GTCCCGCCTCCTGAATCCAATGG - Intergenic
1036871355 8:12436729-12436751 GTCCCGCCTCCTGAATCCAATGG - Intergenic
1043983167 8:86663992-86664014 CTCCCCCCTTGTGAGTCTAATGG + Intronic
1045883877 8:107073113-107073135 CTCCCTCCTTCAGGATCCAAAGG - Intergenic
1047220664 8:122915958-122915980 CTCCCCCTTCCTGCAGCCCAAGG + Intronic
1047512463 8:125526068-125526090 TTCCCCTCTCCTGCATCCAAAGG - Intergenic
1049392939 8:142381418-142381440 CTCCCCCTTCCAGCACCCAATGG + Intronic
1049846319 8:144803520-144803542 CTGCCCACTGCTGCATCCACAGG - Intronic
1050158231 9:2690505-2690527 CTCTCCTCTTCTGCATTCCAAGG - Intergenic
1050213725 9:3296663-3296685 GTTCCTCCTTCTGCATACAACGG - Intronic
1053375809 9:37605369-37605391 CTCCCCCTTACTGCATTGAAAGG + Intronic
1054179912 9:61901479-61901501 CTCCCCCCATCTCCCACCAAGGG - Intergenic
1054657680 9:67679662-67679684 CTCCCCCCATCTCCCACCAAGGG + Intergenic
1058531520 9:105910291-105910313 CTTCCCCTTTCTGCATTCCATGG - Intergenic
1058804424 9:108577330-108577352 CTCCCAGCTTCTGCAGCCCATGG + Intergenic
1059953857 9:119495823-119495845 CTCCCGCCTCCTGCCTGCAATGG - Intronic
1062581627 9:137231499-137231521 ATCCCCCTTTCTCCATCCACAGG - Intronic
1185783426 X:2868534-2868556 CTCCCCACCTCTCCATCCTAAGG + Intronic
1186598325 X:11008338-11008360 CTGCCCACTTCTAGATCCAAAGG - Intergenic
1195943054 X:110180849-110180871 CACTTCCCTTCTCCATCCAAGGG + Intronic
1197127551 X:122965301-122965323 TTTCCCCCTTCTGAATCCAGAGG - Intergenic
1199981512 X:152923184-152923206 CTCTCCCCTTCTGGATGCAGGGG - Intronic