ID: 1089433199

View in Genome Browser
Species Human (GRCh38)
Location 11:118438565-118438587
Sequence CAGAGCACGCAGGAAACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089433199_1089433205 4 Left 1089433199 11:118438565-118438587 CCAGCCGTTTCCTGCGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1089433205 11:118438592-118438614 TGGTGCACACAAAATATCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 98
1089433199_1089433204 3 Left 1089433199 11:118438565-118438587 CCAGCCGTTTCCTGCGTGCTCTG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1089433204 11:118438591-118438613 TTGGTGCACACAAAATATCCTGG 0: 1
1: 0
2: 0
3: 17
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089433199 Original CRISPR CAGAGCACGCAGGAAACGGC TGG (reversed) Intronic
900387590 1:2417609-2417631 CAGTGCTCGCAGGACAGGGCCGG - Intergenic
901456932 1:9368376-9368398 CAGAGCCCCCTGGAAACTGCAGG - Exonic
902076512 1:13790922-13790944 CAGAGTACCCAGCAAACAGCAGG - Intronic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
903550783 1:24156360-24156382 GAGAGCACCCAGGACACAGCAGG + Exonic
905941000 1:41863281-41863303 CAGAGAACGCTGGAAAAGGATGG + Intronic
907302718 1:53498641-53498663 CAGAGCCCCCAGGAAACCCCAGG + Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
910654225 1:89603695-89603717 CAGATCACACTGGAAATGGCAGG - Intergenic
918415110 1:184298413-184298435 CACAGCACACAGGACACGGTGGG + Intergenic
919464552 1:197913272-197913294 CAGAGAACGCGCGAAAGGGCAGG + Intronic
920765847 1:208833012-208833034 CTGAGCACTCAGGACACTGCTGG - Intergenic
922134091 1:222807707-222807729 CTGAGAACCCAGGGAACGGCTGG + Intergenic
1062961106 10:1574222-1574244 CACAGCATGAAGGAAACAGCCGG + Intronic
1063885250 10:10570834-10570856 AAGAGCATGCAGGAAATGGTGGG + Intergenic
1069624184 10:69857300-69857322 CAGAGCAGGCTGGACAGGGCTGG - Intronic
1069739004 10:70675595-70675617 CAGAGCAGCCAGGAAAGAGCAGG - Intronic
1072312729 10:94171948-94171970 CAGAGAAGGCAGGAAACGTGGGG + Intronic
1073136878 10:101225047-101225069 CAGAGAAGGAAGGAGACGGCAGG - Intergenic
1076164099 10:128268263-128268285 CAGAGCAGGCGGGAAGAGGCAGG + Intergenic
1078661933 11:13294839-13294861 CAGAGAACACTGGAAACGGCAGG - Intronic
1081673592 11:44955451-44955473 CACAGGAAGCAGGAAAGGGCTGG - Intergenic
1084172515 11:67407302-67407324 CAGAGCCCGCAGGCACCTGCTGG + Intronic
1085623041 11:78051437-78051459 CAGAGTAAGCAGGAAAGGTCTGG + Intronic
1089262903 11:117234631-117234653 CAGTCCACGTAGGAAAGGGCTGG - Intronic
1089433199 11:118438565-118438587 CAGAGCACGCAGGAAACGGCTGG - Intronic
1089935470 11:122359758-122359780 CAGAGCCCCCAGGAAACCCCTGG + Intergenic
1090168825 11:124580357-124580379 GAGAAGACGCAGGAAAGGGCAGG + Intergenic
1090296827 11:125595493-125595515 GAGAGCACTCAAGAAAAGGCAGG - Intronic
1096339779 12:50787862-50787884 CAGAGAACAAAGGAAAGGGCAGG + Intronic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1103237345 12:119384579-119384601 CGGAGCTCGCAGGGAATGGCAGG - Intronic
1104904355 12:132205445-132205467 CACAGCACGCAGCTAACGCCAGG + Intronic
1105756257 13:23466849-23466871 CAGGGCTCGCAGGAAAGCGCAGG - Intergenic
1107316002 13:39132937-39132959 CAGAGCATTCAGGATACTGCAGG + Intergenic
1110722466 13:78779779-78779801 CAAAGCACCCAGGTAACAGCTGG + Intergenic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1120810881 14:88802422-88802444 CAGAGCAGGGAGGAACTGGCTGG - Intergenic
1121776282 14:96593144-96593166 TAGAGCACGCGGGAAAAGCCGGG - Intergenic
1122026937 14:98885096-98885118 CAGAGCAGGCTGGACACGGAGGG - Intergenic
1124013017 15:25853731-25853753 CATAGCACCCAGGAACAGGCAGG + Intronic
1127094432 15:55498442-55498464 CGGAGCACGCTGGGAACGCCGGG - Exonic
1128882922 15:71260033-71260055 CAGACCACGCAGAAAAGGTCTGG - Intronic
1130993120 15:88888626-88888648 GAGAGCACGCAGTAAATGGCAGG - Intronic
1131062263 15:89411342-89411364 CAGAGCACCCAGGCCACAGCGGG - Intergenic
1133116112 16:3578880-3578902 CTGAGCACCCAGGAACCTGCTGG + Intergenic
1134771648 16:16814438-16814460 CAGAGAAAGCAGGAAACAGAAGG - Intergenic
1143002443 17:3803102-3803124 CACAGCACGCAGCACAAGGCTGG + Intergenic
1148842152 17:50505986-50506008 GAGAGGAAGCAGGAAAGGGCTGG - Intergenic
1150577575 17:66443732-66443754 CAGAGGATGGAGGAAAGGGCAGG + Intronic
1152809435 17:82374551-82374573 CACCGCACGCAGGGAGCGGCAGG - Exonic
1153006291 18:500857-500879 CAGGGCGCGCAGGAGAGGGCGGG - Intergenic
1153119049 18:1699248-1699270 CAGAGAAGGCAGAAAACGGTGGG - Intergenic
1154325927 18:13390368-13390390 CAGTGCAGGCAGGAACTGGCTGG + Intronic
1157911308 18:51619662-51619684 CAGAGCAGGCAGCAAAGGGCAGG + Intergenic
1160225808 18:77009784-77009806 CTGAGAGCTCAGGAAACGGCAGG + Intronic
1162085142 19:8244192-8244214 CAGAAAAGGCAGGAAATGGCTGG + Intronic
1163304319 19:16468187-16468209 CAGGGCAGGCAGCATACGGCAGG + Intronic
1164426985 19:28150364-28150386 CAGAGGACTAAGGAAAGGGCAGG - Intergenic
1164443563 19:28298638-28298660 CAGAGAACACAGGGAAGGGCAGG + Intergenic
1165949341 19:39465187-39465209 GTGAGCACACAGGAAACGGTTGG + Intronic
1166694631 19:44845858-44845880 CCGGGCAGGCAGGAAAGGGCAGG + Intergenic
1167267422 19:48490671-48490693 CAGAGCAGGGAGGACACAGCTGG - Intronic
1168319983 19:55503454-55503476 GAGAGCACGCGGGAGACTGCAGG - Intronic
1168670621 19:58238518-58238540 GAGAGCACGCAGGAGGCGTCAGG + Intronic
925265165 2:2561889-2561911 CCGGGCACGCAGGAAACGCTCGG + Intergenic
925307463 2:2859333-2859355 CAGAGCACGCAGGCAGAGGCTGG + Intergenic
929138697 2:38648689-38648711 CAGAGCACACAGAAAACAGGTGG + Intergenic
932618351 2:73250537-73250559 CACACCACCCAGGAAAGGGCAGG - Intronic
933797990 2:85936651-85936673 CAGAGCACGCGGGAAGGGGCAGG + Intergenic
936547534 2:113405430-113405452 CAGAGCACCCAGGGACAGGCTGG + Intergenic
936821180 2:116523416-116523438 CAGAGCACTCAGGCAAAGGAAGG - Intergenic
942996818 2:182272302-182272324 CAGAGCACTAAGGAAAGTGCAGG - Intronic
947074491 2:226327561-226327583 CAGAGCAAGCAGGAAATGCAGGG + Intergenic
948109824 2:235445479-235445501 CAGAGCATGGAGGAAACAGGTGG - Intergenic
948851627 2:240711162-240711184 CAGAGCAGGCAGGAAGCTGGGGG + Intergenic
1171036201 20:21714581-21714603 CCGAGCCCGGAGGGAACGGCAGG + Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173954169 20:47017952-47017974 CAGAGGAGGCAGGAAAGTGCCGG - Intronic
1175341831 20:58236857-58236879 AAAAGCATGCAGGAGACGGCTGG + Intergenic
1179817831 21:43918997-43919019 CAGAGCAGGCAGGAAAGTGAAGG - Intronic
1180247719 21:46559426-46559448 CAGTGCACGCAGGGCAGGGCGGG + Intronic
1180757517 22:18172925-18172947 CAGAGCACGCAAGAGATGGAAGG - Intronic
1180831930 22:18910972-18910994 CAGAGCACACTGGAGAAGGCGGG + Exonic
1181067915 22:20315370-20315392 CAGAGCACACTGGAGAAGGCGGG - Exonic
1181461399 22:23088270-23088292 CAGAGCATGCAGGGACCAGCAGG - Intronic
1183945752 22:41324883-41324905 AGGAGCAGGCAGGAAAAGGCAGG - Intronic
1184652198 22:45924606-45924628 CTGAGCATGAAGGAAAAGGCTGG + Intronic
1185101190 22:48841754-48841776 CAGAGCCCCCAGGATACAGCGGG - Intronic
1203282008 22_KI270734v1_random:136243-136265 CAGAGCACACTGGAGAAGGCGGG + Intergenic
951344952 3:21536857-21536879 CAAAGCACGCAGAAATCGGAGGG + Intronic
961318013 3:126053836-126053858 CAGAGCAGGAAGGACACGGGTGG - Intronic
961524756 3:127489601-127489623 CGGAGGACAGAGGAAACGGCAGG + Intergenic
962888632 3:139651843-139651865 CAGAGAAGGCAGGAAATGGTTGG - Intronic
963008436 3:140748235-140748257 CAGAGCAAAGAGGAAACAGCAGG - Intergenic
968035401 3:195543851-195543873 CAGAGAGCGCAGGAGACGGGAGG + Intergenic
968121309 3:196127981-196128003 CAGAGCAGCCAGGACAGGGCAGG + Intergenic
969306145 4:6327328-6327350 AAGTGCACGCAGGAAGTGGCGGG + Intronic
970548373 4:17153513-17153535 GAGAGAACACAGGAAAAGGCAGG + Intergenic
975394979 4:73864187-73864209 CAAGGCAGGCAGGAACCGGCGGG - Intergenic
981721153 4:147802819-147802841 CAGAACATGCAGAAAACAGCAGG - Intronic
982256397 4:153455476-153455498 CAAAGCACTTAGGAAAGGGCTGG + Intergenic
985272692 4:188209146-188209168 CAGAGCACTTCGGAAAGGGCAGG - Intergenic
986065344 5:4229403-4229425 CAGAGGGCGCAGGACACGGAAGG + Intergenic
986797316 5:11224608-11224630 CACAGCCTGCAGGAAACAGCTGG - Intronic
987045922 5:14108244-14108266 CACAGCACTTAGCAAACGGCTGG + Intergenic
987661966 5:20889309-20889331 GAGAGCCCGCAGAAAACTGCTGG + Intergenic
988761618 5:34316006-34316028 GAGAGCCCGCAGAAAACTGCTGG - Intergenic
992497492 5:77308255-77308277 CAGACCAAGAAGGAAAAGGCAGG + Intronic
993050943 5:82925136-82925158 CAGAGAAAGCAGGAAACTGGAGG - Intergenic
997634536 5:135395266-135395288 CAGGGCACTCATGAAACCGCTGG + Intronic
998097441 5:139404142-139404164 CAGAGCACCCTGGCAACGGGGGG + Intergenic
998859056 5:146425302-146425324 CAAAGCAGGCAGGAAGCGGGTGG + Intergenic
999325177 5:150639347-150639369 CAGAGCTCAGAGGAAACGGCAGG - Intronic
1000957715 5:167562179-167562201 CAAAGCATGCAGGAGACGGATGG - Intronic
1003026236 6:2558170-2558192 CAGAGCACCGAGGACAGGGCGGG - Intergenic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1010591232 6:77714964-77714986 CAGAGAACTCAGGAAACGCAGGG - Intronic
1014253338 6:119137677-119137699 CAGATGACTCAGGAAATGGCTGG - Intronic
1019180705 6:170186052-170186074 GAGAGCAGGAAGGAAACGGGAGG - Intergenic
1020097563 7:5377260-5377282 CAGGCCCCCCAGGAAACGGCAGG + Intronic
1022089236 7:27096837-27096859 CAGAGCTCGCCGGAAAAGGCCGG + Intergenic
1022482081 7:30751023-30751045 CAGAGCAGGCAGGAAACTGCAGG - Intronic
1023545406 7:41313091-41313113 CATAGCAGGCAGGAGACAGCAGG - Intergenic
1026231237 7:68485712-68485734 CAGAGAAAGCTGGAAACAGCAGG + Intergenic
1028184702 7:87768753-87768775 GAGACCATGCAGGAAACAGCTGG - Intronic
1029497042 7:100901358-100901380 CAAAGCATTCAGGAAGCGGCTGG - Intergenic
1032441383 7:131945406-131945428 CAGAGCACCCCGGAAGCGGGAGG + Intergenic
1036678126 8:10851738-10851760 CAGAACACGCGGGAGAAGGCAGG + Intergenic
1036775800 8:11612497-11612519 CAGAGCACGCTGGACAGAGCTGG - Intergenic
1037276421 8:17184603-17184625 GAGAGGGTGCAGGAAACGGCTGG - Intronic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1042777929 8:72455304-72455326 CAGAGCAATCAGGAAAGGGAAGG - Intergenic
1045037088 8:98184252-98184274 CAGAGTAAACAGGAAACGCCGGG + Intergenic
1048384779 8:133901924-133901946 CATAACACGCAGGAAGAGGCTGG + Intergenic
1048636348 8:136300117-136300139 CAGAGCACGCAGGCATGGCCAGG + Intergenic
1049404880 8:142447886-142447908 CAGGGCAGCCAGGAAAGGGCGGG - Intergenic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1053402800 9:37842101-37842123 CAGAGCAGGTAGCAAACAGCCGG - Exonic
1054839264 9:69718359-69718381 CAGTGCATACAGGAAATGGCTGG - Exonic
1059458394 9:114413996-114414018 CAGAGCCCTCAGGATAAGGCTGG + Intronic
1185920221 X:4083313-4083335 CAGAGCCCCCAGGAAACCACTGG + Intergenic
1186519782 X:10195132-10195154 CCAAGCACGCATGGAACGGCAGG - Intronic
1188170360 X:26917598-26917620 CAGAGCCCACAGGAAAAAGCTGG + Intergenic
1190369561 X:49727711-49727733 CACAGGACCCAGGAAATGGCAGG + Intergenic
1191065594 X:56343697-56343719 CAGAGCATGCAGGGAAACGCAGG - Intergenic
1195699036 X:107688565-107688587 CAGAGCAGGCAGGAACCAGAAGG + Intergenic
1199711616 X:150473596-150473618 CAAAGCACATAGGACACGGCAGG + Intronic