ID: 1089438285

View in Genome Browser
Species Human (GRCh38)
Location 11:118491114-118491136
Sequence GGGTTGGTAAATGCAAGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089438279_1089438285 20 Left 1089438279 11:118491071-118491093 CCATGCTGGTGTTCATGATCCCA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1089438281_1089438285 0 Left 1089438281 11:118491091-118491113 CCAGAAGAATATAGATTTAGATT 0: 1
1: 0
2: 2
3: 24
4: 339
Right 1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1089438280_1089438285 1 Left 1089438280 11:118491090-118491112 CCCAGAAGAATATAGATTTAGAT 0: 1
1: 0
2: 1
3: 30
4: 372
Right 1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089438285 Original CRISPR GGGTTGGTAAATGCAAGTCG AGG Intronic
900667703 1:3826636-3826658 GGGTGTGTAAATGCATGTCATGG - Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
916001491 1:160620618-160620640 GGGTTGGTTAATGGAAGAAGGGG - Intronic
918244493 1:182646840-182646862 GGCTTGGTCAAAGCAAGTCAGGG + Exonic
920390535 1:205597737-205597759 GGTTTGGTAAAAGCAAGTTAAGG - Intronic
1070535039 10:77370796-77370818 GAGTTGGTCAATGCAAGGCTGGG - Intronic
1076999001 11:313300-313322 GGGTTGGCAAAGCCAAGTCTGGG - Intronic
1078934292 11:15938432-15938454 AGGTTGGAAAATGCCACTCGGGG - Intergenic
1079036235 11:17022522-17022544 GGGTTGGGAACTGAAAGTCTGGG - Intergenic
1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG + Intronic
1096073513 12:48788733-48788755 GGGTTGGCAAAGGGAAGTCATGG - Intronic
1102383467 12:112486683-112486705 GGGTAGGTAAAAGCAAGCCCTGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1115290930 14:31771796-31771818 GGGCTGGTAAATGGAAGAAGTGG - Intronic
1124922540 15:34040393-34040415 TGGTTGGTAAATGGGAGTAGGGG + Intronic
1125579809 15:40777063-40777085 GGCTTGGTAAATGTGAGTTGAGG - Intronic
1126125229 15:45289526-45289548 GGGATGGTAAAAGGAAGTCCTGG - Intergenic
1131771087 15:95737826-95737848 GTGTTGGTAATTGCAGGTCATGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1147469655 17:40647724-40647746 GGGTCGGTGGGTGCAAGTCGTGG - Intronic
1150553411 17:66231856-66231878 TGGTTGTTAAATGCAATTCTTGG + Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1166663288 19:44661435-44661457 GGGTTGGGAAATGCTGCTCGAGG - Intronic
925455455 2:4012834-4012856 GTGTTTGTAAATGTAAGACGAGG + Intergenic
926309034 2:11661138-11661160 GAGTTGTAAAATGCAAGCCGCGG - Intronic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935659696 2:105455574-105455596 GGGTAGGAGAATGCAAGTGGAGG - Intergenic
942244154 2:173991677-173991699 GAGTTGCTAAATGCAACTCTGGG + Intergenic
942778886 2:179617249-179617271 GGGTTTGTAAATCCAAGGCAGGG + Intronic
1178676662 21:34636985-34637007 AGGCTGGTAAATGCTAGTGGAGG - Intergenic
950464234 3:13143798-13143820 GGGTTGGGAAAGGAAAGTCCAGG + Intergenic
950470716 3:13184543-13184565 GGGTGGGAAAATGCAGGTCCTGG - Intergenic
950493312 3:13319169-13319191 GGGTTGGTTAGAGCAGGTCGGGG + Intronic
952018367 3:28986802-28986824 GGGTTGGAAAATGAAAGTTGAGG + Intergenic
955128487 3:56139118-56139140 GATTTGGTAAATCCAAGTCAAGG - Intronic
961097631 3:124171552-124171574 GGATTGGTCAAAGCAAGTCATGG + Intronic
969720370 4:8890225-8890247 GGCTTGGGAAAAGCAAGGCGGGG - Intergenic
979781503 4:124656808-124656830 GGGTTGGTAAAAGCGAGACATGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
999281276 5:150367846-150367868 GAGTTGGTAGATGCTAGTCTTGG - Exonic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1011896262 6:92229767-92229789 GGGTTGCTAAATTTAAGTCCTGG - Intergenic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1020974978 7:14994455-14994477 ATGATGGTAAATGCAAGTCACGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027910919 7:84249214-84249236 GTGTGGGTAAATACAAGTAGAGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1044079156 8:87862733-87862755 GTGTTGGTAAATGAAGGTTGAGG + Intergenic
1047822484 8:128536382-128536404 AGGTTGGTAAATGCCAGCCAAGG + Intergenic
1055994483 9:82142483-82142505 AGGTTGCTAAATGCCAGTTGTGG + Intergenic
1058123769 9:101168268-101168290 GGGTTGTTGAATGCAAGTTAAGG - Intronic
1062188935 9:135236987-135237009 GACTTGGTAAATGCAATTAGGGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191696090 X:63992313-63992335 GGGTTAGTAATTGCAAGACTGGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic