ID: 1089438358

View in Genome Browser
Species Human (GRCh38)
Location 11:118492151-118492173
Sequence CTTTATACTCTGAAGGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089438358 Original CRISPR CTTTATACTCTGAAGGTGAT AGG Intronic
905492692 1:38356844-38356866 CCTTATATTTTGTAGGTGATGGG + Intergenic
907694588 1:56710124-56710146 TTGTAAACTCTGAATGTGATAGG + Exonic
910012598 1:82483828-82483850 TTTTATACTCTCAAGATGTTTGG - Intergenic
910730607 1:90391935-90391957 CTTTTTACTCTGATTGAGATAGG - Intergenic
910784504 1:90980458-90980480 CATTTTATTCTGAAAGTGATGGG + Intronic
910859573 1:91730744-91730766 CTTTATACTCTGAAGATGAAAGG + Intronic
912843503 1:113059690-113059712 ATTTATACCCTGAAGGTGTGGGG - Intergenic
913547315 1:119881977-119881999 CTTTATTCTGAGCAGGTGATGGG + Intergenic
917922110 1:179759297-179759319 GTTTATCCTCTCAATGTGATGGG - Intronic
918881108 1:190122552-190122574 CTTTACCCTCTGAAGGTTCTAGG - Intronic
919448289 1:197737871-197737893 CTTTATTTCCTCAAGGTGATTGG - Intronic
919678139 1:200407722-200407744 CTTTATCATTTGAAGGTGTTTGG + Exonic
919743977 1:200997200-200997222 CCTTATACTCTGAGGGAGACGGG - Intronic
920148175 1:203880941-203880963 CTTTAGATTCTGAACTTGATAGG + Intergenic
920515051 1:206579084-206579106 CTTTTAGCTCTGGAGGTGATTGG - Intronic
921688689 1:218121850-218121872 CTTTATGCTCTGAAGTGGTTTGG - Intergenic
921879018 1:220232447-220232469 CATAATACGGTGAAGGTGATAGG - Intronic
923815232 1:237370248-237370270 CTTCCTACTGTGAAGGAGATTGG - Intronic
924055252 1:240118552-240118574 GATTTTACTCTGAGGGTGATGGG + Intronic
924859631 1:247907786-247907808 GTTAATACTCTGGAGGTGGTGGG + Intergenic
1065996676 10:31065728-31065750 CTGTATACTATTCAGGTGATGGG + Intergenic
1066504891 10:36031242-36031264 CATTAGACTGTGAAGGAGATGGG + Intergenic
1066527421 10:36296538-36296560 CTTTTTAGTCAGCAGGTGATGGG + Intergenic
1067580075 10:47439242-47439264 CTTTATAAACAGAAGGTCATGGG - Intergenic
1067993175 10:51238804-51238826 CTTTATATTCTAAATGTGAAGGG - Intronic
1071103892 10:82071644-82071666 CTTTTTACTCAGAAAGGGATGGG + Intronic
1071176400 10:82931410-82931432 TTATATACTCAGAAGGTGAAAGG - Intronic
1072444706 10:95488989-95489011 ATTTTTACTCTGAGAGTGATTGG - Intronic
1072557219 10:96529346-96529368 CTTTTTACTCTGATGTTTATTGG - Intronic
1073038122 10:100578503-100578525 TTTTATACTCTGACACTGATGGG + Intergenic
1075011742 10:118876328-118876350 TTTTATATTCTGAAGGTCAATGG - Intergenic
1075186546 10:120264303-120264325 ATTTATACTCAGAACCTGATGGG + Intergenic
1077976843 11:7255396-7255418 GTTTTTACTCTGAATGAGATAGG + Intronic
1078709793 11:13779917-13779939 CTTAACAATCTGAAGGTGCTGGG + Intergenic
1078989337 11:16630553-16630575 CTGTATACTCTGTGGTTGATGGG + Intronic
1079498648 11:21076123-21076145 TTTTATTCTCTGTATGTGATTGG + Intronic
1082659421 11:55892302-55892324 ATTCATGCTCTGAAGGTGAAGGG + Intergenic
1083786178 11:64949013-64949035 TTTTATTCTCTGAAGGCCATGGG - Intronic
1085834088 11:79933965-79933987 CTTTATCCTCTGAAGAACATGGG - Intergenic
1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG + Intergenic
1087969603 11:104463418-104463440 CTCTATACTCTGTGGGTGACGGG - Intergenic
1088794881 11:113259547-113259569 CTGCATGCCCTGAAGGTGATGGG + Intronic
1089010084 11:115125007-115125029 CTTTATCCTTTGAAGGAGATTGG + Intergenic
1089438358 11:118492151-118492173 CTTTATACTCTGAAGGTGATAGG + Intronic
1090889837 11:130914258-130914280 CTCTATACTGTGAAGGTAACAGG - Exonic
1093867546 12:24246952-24246974 CTTTTTCCTTTGAAAGTGATGGG - Intergenic
1095810013 12:46363425-46363447 TTACATAGTCTGAAGGTGATGGG + Intronic
1096761130 12:53842875-53842897 CATTAGACTCTGAAAGTGTTGGG + Intergenic
1098812691 12:75116047-75116069 CTTTATATTTTTAAAGTGATAGG + Intronic
1098938342 12:76505868-76505890 TTTTTTACTCTGAATGAGATGGG + Intronic
1099220387 12:79907212-79907234 CTTAATAATCTTAGGGTGATTGG - Intronic
1099573351 12:84353668-84353690 TTTTATAAGCTGAATGTGATTGG + Intergenic
1099873719 12:88379390-88379412 TTTTATATTTTGAAGATGATTGG - Intergenic
1100654333 12:96624423-96624445 CTTTCTACTCTGAAAGGCATTGG - Intronic
1102060128 12:109925520-109925542 CTCTATCCCCTGAAGCTGATAGG - Intronic
1103473811 12:121203593-121203615 CTTTCTTCTCTGCAGGTGACTGG - Intergenic
1103593713 12:122010185-122010207 CTTTATAATCTGAGCGAGATGGG + Intergenic
1105663402 13:22525083-22525105 ATTTATACCCAGAAGTTGATTGG - Intergenic
1109099014 13:58155873-58155895 CTCTAAACACTGAAGGAGATTGG + Intergenic
1109743738 13:66592131-66592153 TTTTATAACCTGAAAGTGATTGG + Intronic
1110531547 13:76603944-76603966 CTTCATTCTCAGAAGATGATGGG + Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1114776217 14:25484915-25484937 CTTTATTCTTTGAAGGTGCTTGG + Intergenic
1115718854 14:36137382-36137404 GATTATACTCTGAATGAGATGGG + Intergenic
1118112403 14:62736306-62736328 ATTTCTGCTCTGAATGTGATAGG - Intronic
1118904493 14:70013765-70013787 GTTTAATCTCAGAAGGTGATGGG + Intronic
1121732987 14:96199180-96199202 TTCTATACTCTCAAGGTGAATGG + Intergenic
1124813804 15:32968508-32968530 CTGTATTCTCTGAAGATGCTGGG - Intronic
1127102465 15:55581446-55581468 ATTTTTACTCTAAAGGTAATAGG + Intronic
1127700887 15:61499369-61499391 CTTTATACTATGAGTGTGTTGGG + Intergenic
1128615927 15:69109745-69109767 CTTTTTACTCTGAAGGCAAGGGG - Intergenic
1131886125 15:96915111-96915133 CTTTAGTCTCTGAAAGTGCTGGG - Intergenic
1135903886 16:26492606-26492628 GTATATGCTCTAAAGGTGATAGG - Intergenic
1138060250 16:53882709-53882731 CTTTTTACTCTGCAGGAAATGGG + Intronic
1138262405 16:55634527-55634549 CTTGATGGTCTGAAGGTGAGAGG - Intergenic
1139753879 16:69127283-69127305 CTGTCTACTCTCAAGGGGATGGG - Intronic
1140746356 16:77983679-77983701 CTTTATATTCTGAAGTTAATGGG + Intergenic
1146533033 17:33626910-33626932 GTTTTTATTCTGAAGGTGAGGGG - Intronic
1148974572 17:51515796-51515818 CTTTATGCTCTGTGGGAGATGGG + Intergenic
1152886501 17:82854226-82854248 GTTGACACTCTGCAGGTGATGGG + Intronic
1154079356 18:11240274-11240296 CTTTAGACTATGAATTTGATGGG - Intergenic
1154162099 18:11988418-11988440 CTTTTTACTCTGAATGTGAGGGG + Intronic
1155646804 18:28088560-28088582 TTTCAGACCCTGAAGGTGATGGG + Intronic
1155834033 18:30556182-30556204 TTTTCTACTCTGAAGGAGTTTGG + Intergenic
1156916846 18:42472019-42472041 GTTTCTACTCTGGGGGTGATGGG - Intergenic
1159422961 18:68247161-68247183 CATTATACCCTGAGGGTGCTGGG - Intergenic
1159565888 18:70049129-70049151 TTTTATACTCTGCAGGTAACTGG + Intronic
1160211207 18:76881585-76881607 TTTTTTCCTCTGAAGGTGATAGG + Intronic
1162541440 19:11298796-11298818 CCTTATACCCTGCAGGTGAGGGG - Intronic
1164439409 19:28261166-28261188 CCTTAGGCTCTGAGGGTGATAGG + Intergenic
1166887209 19:45969252-45969274 CTTCATCCTCTCAAGGTGCTGGG - Intronic
1166929160 19:46290913-46290935 GCTTTTACTCTGAAGGAGATGGG - Intergenic
1167950069 19:53019383-53019405 ATTTCTCCTCGGAAGGTGATTGG - Intergenic
926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG + Intronic
929491257 2:42398628-42398650 CCTTTTACTCTGCAAGTGATGGG + Intronic
930429920 2:51262892-51262914 CATTTTACTCTAAATGTGATAGG + Intergenic
930591648 2:53334586-53334608 GTTTTTACTCTGAATGTAATGGG - Intergenic
932271798 2:70417275-70417297 CTTAATATTCTGAATGAGATGGG + Intergenic
933652233 2:84858782-84858804 CTTTACACACTGAAGGTCCTGGG + Intronic
935253461 2:101286666-101286688 TTTTTTATTCTGAAAGTGATAGG - Intronic
935800319 2:106689225-106689247 GCTTTTACTCTGAATGTGATGGG + Intergenic
937642433 2:124228856-124228878 TTTGATGCTCTGAAGGTCATGGG - Intronic
938851935 2:135269403-135269425 CTTTATTCTCTGATGATGAACGG + Intronic
943471750 2:188303240-188303262 CTTTTTGCCCTGAAGGTGGTAGG + Intronic
943632675 2:190271855-190271877 TTTTATACTGTGAAGGAGATAGG - Intronic
943676414 2:190720160-190720182 CTTTGGCCTCTGAAGGTGCTGGG + Intergenic
945411314 2:209511820-209511842 CTTCAGCCTCTGAAGGTGCTAGG + Intronic
947506382 2:230711460-230711482 GTTTTTACTCTCAAGGAGATGGG - Intergenic
1169690639 20:8327134-8327156 CCTTGGACTCTGAAAGTGATGGG + Intronic
1170485481 20:16811457-16811479 CTTTATACACTGAAAGCCATGGG - Intergenic
1170720977 20:18879086-18879108 CTTAATTCTCTAAAGCTGATTGG + Intergenic
1177158854 21:17526443-17526465 CTTTATACTCAAGATGTGATTGG - Intronic
1177570435 21:22878914-22878936 CTTCATAGTCTGATGGTGACAGG + Intergenic
1182203047 22:28593030-28593052 CATTATTCTCTGAAGGTGGCTGG + Intronic
1182411593 22:30191472-30191494 CTTTGTACCCTGAAGGGGAGGGG - Intergenic
951870495 3:27356258-27356280 CTTCAGCCTCTGAAGGTGTTAGG - Intronic
956339058 3:68200211-68200233 TTTTATACACTGAATTTGATTGG + Intronic
956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG + Intronic
960560693 3:119080253-119080275 CTTTATACTCTGAGGATTATGGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962805714 3:138925722-138925744 CTTTGTCCTCCCAAGGTGATGGG + Intergenic
963458178 3:145573597-145573619 CTTGATGGCCTGAAGGTGATAGG + Intergenic
963472457 3:145758774-145758796 CTTAATATTCTGATGTTGATGGG - Intergenic
964181558 3:153893736-153893758 ATTTATACTCTGAATGAAATAGG + Intergenic
964372849 3:156019175-156019197 TTCTATACTCTGAAGGAGAGAGG + Intergenic
972091185 4:35286310-35286332 CTTTATATTCTGATGCTGTTTGG + Intergenic
972863926 4:43206721-43206743 ATTTATACTTTCAATGTGATTGG - Intergenic
974794288 4:66728803-66728825 CTTTATACTCTGCATGTAACTGG - Intergenic
977203413 4:94143106-94143128 CTTAATAGACTGAAGGTAATGGG + Intergenic
977788592 4:101070563-101070585 CTTTATACTTTAAAAGTGAGAGG - Intronic
978168617 4:105640770-105640792 CTCTAAATTCTGAAGGTGAATGG - Intronic
979384132 4:120043929-120043951 CTTTGGACTCTGAAGGCAATAGG + Intergenic
981689773 4:147494785-147494807 CTTTTTTCTCTGAATGAGATGGG + Intronic
982341831 4:154308163-154308185 CTTTATAATCAGAAGGTCATTGG - Intronic
983073290 4:163294430-163294452 CTTTATACCATGAACATGATTGG - Intergenic
984240069 4:177207628-177207650 CTTTTTACTCTAAAGTTGGTTGG + Intergenic
984515095 4:180728018-180728040 CTTTATACTCTGAAGATAGGAGG + Intergenic
984554178 4:181194428-181194450 CATTTTACTCTAAATGTGATGGG + Intergenic
984749836 4:183261465-183261487 CTTTATCCTCTGAAAGAGACTGG - Exonic
985212933 4:187614321-187614343 CTTTATAAATTGAATGTGATTGG - Intergenic
986059032 5:4170560-4170582 CCTTATCCTCTGAAAGTGCTGGG + Intergenic
989256847 5:39375535-39375557 GTTTATACTGTGAAGGTTCTTGG + Intronic
989712548 5:44417393-44417415 CTTTTTACTCTTAAGGTCTTTGG - Intergenic
991723996 5:69517806-69517828 CTTTAAAGTGTGAAGGTGTTAGG + Intronic
992351342 5:75932223-75932245 CTTTATACTCCCAAGATGAGTGG - Intergenic
993499538 5:88649577-88649599 GTGTATACTCTTCAGGTGATGGG + Intergenic
993870760 5:93251604-93251626 ATTTACACTCTGATGGGGATGGG - Intergenic
993947108 5:94128755-94128777 CTTTTTACTCTGAATGAAATGGG + Intergenic
994440207 5:99792560-99792582 CTTTATACTCTCAATGTGAATGG - Intergenic
995187245 5:109284732-109284754 CTGTATATTCTGAAGTTGTTGGG - Intergenic
1004358686 6:14952073-14952095 CTTTCAAGTCTCAAGGTGATGGG + Intergenic
1007332314 6:41122361-41122383 CTTTTTACTCTGAAGGTTTTAGG + Intergenic
1008783413 6:55136194-55136216 CTTTATTCTCTGAAGCTCAAAGG + Intronic
1009366886 6:62863222-62863244 CTTAATATTCTGAAGGGGAAAGG - Intergenic
1009439865 6:63664380-63664402 TGTTTTACTCTGAAGGAGATGGG + Intronic
1010343193 6:74781382-74781404 CTCTTTATTCAGAAGGTGATGGG - Intergenic
1012727253 6:102830128-102830150 CTTTATACACTGTAGGTGGCAGG - Intergenic
1014473474 6:121844503-121844525 CTTCATCCTCTGAACGTGCTTGG - Intergenic
1015564913 6:134559513-134559535 GTTTATACTGCTAAGGTGATGGG - Intergenic
1015872828 6:137794339-137794361 CTCTGTACCCTGAACGTGATAGG - Intergenic
1018401416 6:163424564-163424586 CCAAATACTCTGAAGTTGATGGG + Intronic
1021263516 7:18489930-18489952 CATTGTACTCTTAAGATGATGGG - Intronic
1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG + Intergenic
1030222427 7:107110715-107110737 CTCTTTAGTCTGCAGGTGATGGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031152188 7:118067127-118067149 CTTTCTACTGTGAAAGAGATGGG + Intergenic
1032130889 7:129226151-129226173 TATTATAATCTGAAAGTGATAGG + Intronic
1032694649 7:134324534-134324556 ATGTATACTCTTTAGGTGATGGG + Intergenic
1034068492 7:148159732-148159754 ATTTATACTCAGAAACTGATAGG - Intronic
1036171945 8:6495747-6495769 CTTTAATCACTGAAAGTGATTGG - Intronic
1036430132 8:8682063-8682085 TTTTAATATCTGAAGGTGATAGG + Intergenic
1036936204 8:13004614-13004636 CTCTTTAGTCAGAAGGTGATGGG - Intronic
1038774952 8:30520622-30520644 CATTATACTCTAACAGTGATAGG - Intronic
1038792760 8:30683210-30683232 CTTCAGCCTCTGAAAGTGATGGG + Intronic
1039191483 8:34981159-34981181 CTTTATACTCCTCAGGTCATTGG - Intergenic
1042767247 8:72337027-72337049 CCTTGCACTCTGAGGGTGATGGG - Intergenic
1042895878 8:73667324-73667346 GATTTTATTCTGAAGGTGATTGG - Intronic
1043223123 8:77691716-77691738 GTGTATACTCTTCAGGTGATGGG + Intergenic
1044271457 8:90249323-90249345 GTGTATACTGTGTAGGTGATAGG + Intergenic
1044770711 8:95628670-95628692 CTTTTCACTGTGAAGGTTATAGG - Intergenic
1048396692 8:134020705-134020727 CTTTGTGCTCTGGAGGGGATGGG + Intergenic
1049985162 9:943604-943626 CCTTAAATTCTGAAGGTCATGGG + Intronic
1050350329 9:4735141-4735163 CTTTAGCCTCTCAAGGTGTTGGG - Intronic
1056341249 9:85634522-85634544 GTTTTTACTCTGAATGAGATTGG + Intronic
1056951915 9:91046898-91046920 CTTTAGACTCTCAAAGTGCTGGG - Intergenic
1058083268 9:100721692-100721714 CTTTGGACTCTGAAAGTGCTGGG + Intergenic
1058711987 9:107687090-107687112 CTTTATGCTCAAAAAGTGATTGG - Intergenic
1186478239 X:9875756-9875778 TTGTATTCTCTGAATGTGATAGG + Intronic
1186745561 X:12564608-12564630 CTTTATACTCAGTAAGTCATTGG + Intronic
1187237079 X:17477504-17477526 CCTTTTACTCTGAATGAGATGGG + Intronic
1187487598 X:19719340-19719362 CATTAGACTCTGAAGTTCATAGG - Intronic
1188124098 X:26346281-26346303 TTTCATTCTCTGAAGGTGGTTGG + Intergenic
1188415780 X:29932245-29932267 CTTTATAATCTAAAGGGGAAAGG + Intronic
1190570556 X:51777614-51777636 CTTTTTACTCTTAAGGTCCTTGG + Intergenic
1190711518 X:53075029-53075051 CTTTTTCCTCTGAATGAGATGGG - Intronic
1191184757 X:57597705-57597727 CTTTACACTTTCAAGGTAATAGG + Intergenic
1191624817 X:63259119-63259141 CTTTTGACTCTGAAGGTCCTCGG - Intergenic
1193354143 X:80497361-80497383 CTTTATACACTGTTGGTGAGAGG - Intergenic
1194201440 X:90957703-90957725 CTTTATTCTCTGAAGTAGAGTGG - Intergenic
1196595321 X:117539249-117539271 CTTTGACCTCTCAAGGTGATGGG - Intergenic
1197069971 X:122285063-122285085 CTTCAGGTTCTGAAGGTGATTGG + Intergenic
1197162698 X:123341940-123341962 CTTCATCCTCTGAAGTAGATAGG + Intronic
1198430842 X:136564920-136564942 CTTTTTAGTCAGCAGGTGATTGG + Intergenic
1200547280 Y:4533158-4533180 CTTTATTCTCTGAAGTAGAGTGG - Intergenic