ID: 1089438456

View in Genome Browser
Species Human (GRCh38)
Location 11:118493102-118493124
Sequence CCTTCGGGGGAGCTGCGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089438456_1089438468 15 Left 1089438456 11:118493102-118493124 CCTTCCCGCAGCTCCCCCGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1089438468 11:118493140-118493162 TCTTACTGAGGTCAGCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 129
1089438456_1089438465 3 Left 1089438456 11:118493102-118493124 CCTTCCCGCAGCTCCCCCGAAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1089438465 11:118493128-118493150 TGATCCACCAGTTCTTACTGAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089438456 Original CRISPR CCTTCGGGGGAGCTGCGGGA AGG (reversed) Exonic
900307588 1:2018873-2018895 CCTTCGCGGGAGCTGGGGCCAGG - Intergenic
900645457 1:3706821-3706843 CTGGCGGGGGAGCTGCGGGTAGG + Intronic
904327230 1:29734753-29734775 CCTTCGGGTAAGCTGGGGGTGGG + Intergenic
905819534 1:40979236-40979258 CCTTCGGGGCAGGTGTGGGGAGG + Intergenic
908321132 1:62980108-62980130 CCATCTGGGGAGCTGCAGGCTGG - Intergenic
909548188 1:76869340-76869362 CCTTCCGGGAAGCTGCTGCATGG + Intronic
916118248 1:161506326-161506348 CCTTTGGGGGAGCTGCTGAGGGG - Exonic
916128172 1:161589554-161589576 CCTTTGGGGGAGCTGCTGAGGGG - Intronic
916138088 1:161671384-161671406 CCTTTGGGGGAGCTGCTGAGGGG - Exonic
917458294 1:175204771-175204793 CCTCCTGAGGAGCTGCTGGATGG - Intergenic
917750519 1:178049269-178049291 CCTTTGGGGGAGGTGGGAGATGG - Intergenic
923105057 1:230848022-230848044 GCTTCAGGGGCGCTGCGGAAGGG + Intronic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1067281839 10:44879260-44879282 CCCTACGGGGAGCTGAGGGAAGG - Intergenic
1067298624 10:44990503-44990525 CCGCACGGGGAGCTGCGGGAAGG + Intronic
1067551970 10:47242614-47242636 CCTCAGGGGCAGCTGAGGGAGGG + Intergenic
1069698429 10:70404633-70404655 GCTTCGGTGGAGCTGGGGGCGGG - Intronic
1069913515 10:71773579-71773601 CCCCCGGGGGCGCTGCGCGAAGG - Intronic
1072525393 10:96266736-96266758 ACTTCAGGGGAGCTGCAGGCAGG - Intronic
1072909509 10:99487315-99487337 CCCTGGGGGGAGCTGGGCGAAGG + Intergenic
1073392859 10:103193372-103193394 TCTGCGGCGGAGCTGGGGGACGG - Intergenic
1075332599 10:121584492-121584514 TCTTCGGGTGGGGTGCGGGATGG - Intronic
1076817302 10:132921263-132921285 CCCTCAGGGGACCAGCGGGAAGG + Intronic
1078090295 11:8260871-8260893 CCTTTGGGGGAGCCGGGGGGTGG + Intronic
1083617870 11:64035534-64035556 CCCTCTGGGGAGTTGGGGGAGGG - Intronic
1084150447 11:67285702-67285724 CCCTCGGGGAAGGGGCGGGAGGG - Exonic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1095497295 12:42798320-42798342 CCTTCTGGGGATGTGCGGAATGG + Intergenic
1101596405 12:106169433-106169455 CCTGTGGGGGAGTTGGGGGAAGG + Intergenic
1101615556 12:106333211-106333233 CCTTGGGGGCAGCTGGGTGAAGG + Intronic
1104439704 12:128784845-128784867 CCTACGGGGGAGCTGGGGTAGGG + Intergenic
1104583867 12:130031315-130031337 TTTTGGGGGGAGATGCGGGAAGG - Intergenic
1104735487 12:131133587-131133609 CCTTCCGGGGAGGTGCAGGCAGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1105855204 13:24366049-24366071 CGTGCGGGGGAGCTGTGGGTAGG - Intergenic
1106036792 13:26051304-26051326 CCTTCGGGGATGCTCAGGGAGGG - Intergenic
1107686544 13:42906116-42906138 TCTGCTGGGGAGCTGCAGGATGG + Intronic
1110843272 13:80166893-80166915 CCTTTGGGGGAACTGTGGCATGG - Intergenic
1110863991 13:80374642-80374664 CCTTCAGGGGAACTGAGCGATGG - Intergenic
1113088914 13:106596983-106597005 CTTTCGGGGAAGCTGGGTGAAGG - Intergenic
1113944754 13:114037909-114037931 CGTTCGGGGGAGCCGGGAGAAGG + Intronic
1113944766 13:114037945-114037967 CGTTCGGGGGAGCCGGGAGAAGG + Intronic
1115235850 14:31207833-31207855 CCACCTGGGGCGCTGCGGGACGG + Intergenic
1117330950 14:54711516-54711538 CCTTGGGGGAAGCTGGGTGATGG + Intronic
1117643624 14:57827342-57827364 CTTTCACGGGAGCTGGGGGAGGG + Intronic
1117647219 14:57865455-57865477 CCTTGGGGGGAGGTGCGGAGGGG - Intronic
1118898058 14:69963562-69963584 CCATTGGGGGAGGGGCGGGAGGG - Intronic
1121436622 14:93924885-93924907 CCCTCGGGGCAGCTCCGTGAGGG - Intronic
1122429838 14:101633349-101633371 CCTTCGGGGAAGATGCGGGAGGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1127559359 15:60120353-60120375 CGTGTGGGGGAGCTGAGGGAGGG + Intergenic
1128792543 15:70443704-70443726 CCTCCGGAGGTGCTGGGGGAGGG - Intergenic
1129424517 15:75454343-75454365 CCTGCAGGGGAGCTGAGGGGCGG - Intronic
1129761447 15:78131352-78131374 CCTCCAGGCGAGCTGCGGGGCGG - Exonic
1131367814 15:91854238-91854260 CCGCCGGGGGAGCTGCCGGCCGG + Intronic
1132385438 15:101397032-101397054 CCTTCGGAGGAGGTGCAGGCAGG + Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1140096866 16:71883577-71883599 CCTTGGGTGGAGCTGGGGGAGGG - Intronic
1140250444 16:73289920-73289942 CCTTCAGGGGTGCTGAGGAAAGG + Intergenic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142594043 17:1021006-1021028 CCTTGGGGCGAGCTGCGTGCTGG - Intronic
1142752701 17:1998200-1998222 CCTTTGGGGGAGGGGCGGGGAGG + Intronic
1142827829 17:2525321-2525343 CCTTGGGAGGAGCTGGGGCAAGG - Intergenic
1143174597 17:4948933-4948955 CCTTCGGCGGAGGTGGGGGAAGG - Exonic
1146256064 17:31392066-31392088 CCGGCGGGGGAGCTGGGGGAGGG - Intronic
1147157666 17:38552352-38552374 CCTTTGGGGGAGTTGGGGTAAGG + Intronic
1152297423 17:79476130-79476152 CCATCTGGGGAGCAGCGGCAGGG + Intronic
1153914662 18:9734657-9734679 CCTGCGGGGGAGCAGTGGGGTGG + Intronic
1158592711 18:58791061-58791083 GCTTCGGGAGAGCTGAGGAAGGG + Intergenic
1159918102 18:74203689-74203711 GCTTCAGGGGAGCTGGGGGAAGG + Intergenic
1160690785 19:460129-460151 CCTGCGGTGGGGGTGCGGGAAGG - Intronic
1160969790 19:1762493-1762515 GCTTCCCGGGTGCTGCGGGACGG - Intronic
1161059633 19:2208446-2208468 CCCTCGGGGGAGCAGTGGGAGGG - Intronic
1162328640 19:10013388-10013410 CCTGCAGGGGATCTGTGGGAGGG + Exonic
1162765310 19:12915779-12915801 CATTCGGGGGAGCTAAAGGAAGG - Intronic
1164558153 19:29269246-29269268 CATACGCGGGAGCTGGGGGAGGG + Intergenic
1164889283 19:31809263-31809285 CTGTTGGGGGAGCTGGGGGAGGG + Intergenic
1166217500 19:41345090-41345112 CCTTCGGCTGAGCTGTGTGAAGG - Intronic
1166251052 19:41570968-41570990 GCTTCAGGGAAGCTGCGGGAGGG + Intronic
1167293311 19:48635979-48636001 CCTTCAGGAGACCTGCGGGCCGG + Exonic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
927094386 2:19736544-19736566 CACTCGGGTGAGCTGCAGGAAGG + Intergenic
931587014 2:63840622-63840644 CCCTCGGGGCAGCTGCGGTGGGG + Intergenic
934763668 2:96869244-96869266 CCCTGGGGGGAGCTGCGGGTGGG - Intronic
937459947 2:122076988-122077010 CTATCGCTGGAGCTGCGGGAGGG + Intergenic
937989232 2:127653214-127653236 ATCTCGGAGGAGCTGCGGGAGGG + Intronic
938953469 2:136278301-136278323 CCTTCAGGGAAGCTGTGGGAGGG - Intergenic
948465510 2:238149961-238149983 CCTGCAGGGGGGCTGCAGGAAGG - Intronic
948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG + Intronic
948874508 2:240819714-240819736 CCACCGGCGGGGCTGCGGGAGGG - Intronic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172198666 20:33110002-33110024 CATTAGGGGGAGCTGGGAGAAGG - Intronic
1172620652 20:36316337-36316359 CATTCAGGTGAGCTGCGGGTGGG - Intronic
1173802902 20:45905954-45905976 CCTTCGGGGGAGTTGGGGAAAGG + Intronic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1175234886 20:57503022-57503044 CCCTCGGGGGACCTAGGGGAGGG - Intronic
1175300267 20:57937958-57937980 GGTTCGGGGGAGCTGGGGCATGG + Intergenic
1175400193 20:58695930-58695952 CAGTCTGGGGAGCAGCGGGAGGG - Intronic
1175703298 20:61156329-61156351 CCTTTGTTGGAGCTGGGGGAGGG - Intergenic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1179613869 21:42569392-42569414 CCTTCGGAGGAGCAGCAGGGAGG - Intronic
1180175334 21:46084412-46084434 CCGTCCTGGGGGCTGCGGGAGGG + Intergenic
1180606991 22:17066307-17066329 CCATCTGGAGAGCTGCAGGATGG + Intergenic
1180797705 22:18614871-18614893 ACTTTGGGGCAGCTGCTGGATGG - Intergenic
1181224012 22:21380389-21380411 ACTTTGGGGCAGCTGCTGGATGG + Intergenic
1181254621 22:21554428-21554450 ACTTTGGGGCAGCTGCTGGATGG - Intronic
1182052156 22:27321633-27321655 CCTCCCTGGGAGCTGAGGGATGG - Intergenic
1182094809 22:27618929-27618951 CCTTCGGTGGGGCTGAGGAAAGG - Intergenic
1183262115 22:36802165-36802187 ACATCGGGGGAGCTGGGTGAAGG + Intronic
1183320129 22:37160225-37160247 CCCTGTGGGGAGCAGCGGGATGG + Intronic
1184040446 22:41940025-41940047 CCTGGTGGGGAGCTGCTGGAGGG - Intronic
1184720073 22:46307046-46307068 CCTTGCGGGGAGCTGGAGGAGGG + Intronic
1185101651 22:48843812-48843834 CCCTCGGGGCAGCTGCTGGCAGG + Intronic
949484585 3:4525846-4525868 GCACCGGGGGAGCTGGGGGAGGG - Intronic
953702851 3:45210243-45210265 CCTTCGGTGGAGCTGCCCCAAGG - Intergenic
953957474 3:47243070-47243092 CCTTCGGGGAGTCTGAGGGAAGG + Exonic
960010548 3:112830094-112830116 ACTTCGGGGGAACTGCAGAAAGG + Intronic
969575819 4:8035131-8035153 CAGTGGGGGGAGCTGAGGGAAGG - Intronic
972245885 4:37244990-37245012 CGTTCCGTGGAGCTGCGGGCAGG + Exonic
976583076 4:86762876-86762898 CCATCTGGGGGCCTGCGGGAAGG + Exonic
978174036 4:105708432-105708454 CCTCCGAGGGAGTTGCGGGCCGG - Intronic
978205951 4:106081513-106081535 CTGTTGGGGGAGCTGGGGGAGGG + Intronic
982224486 4:153153373-153153395 CGTGCGGCGGGGCTGCGGGAGGG + Intronic
983936734 4:173507759-173507781 CCTCCGGAGCAGTTGCGGGAGGG + Intergenic
984345688 4:178521850-178521872 ACTTGGGGGGAAGTGCGGGAGGG - Intergenic
986482329 5:8202171-8202193 CTTCAGGGGGAGCTCCGGGAAGG + Intergenic
992627381 5:78648301-78648323 CGGTCGGAGGTGCTGCGGGATGG - Intronic
993356778 5:86922782-86922804 CCTGCGGGGGTGCAGAGGGAGGG - Intergenic
994709992 5:103255455-103255477 CCTTCGGGAGAGATGTGGCAGGG + Intergenic
995357549 5:111256480-111256502 CCTTTGGGGGAACTGAGTGAAGG + Intronic
997791928 5:136769492-136769514 CCTTCGTGGGACTTGTGGGAGGG - Intergenic
999314317 5:150574316-150574338 CCTTCGGAGGCTCTGTGGGAGGG + Intergenic
1001969842 5:175946810-175946832 CATTAGGGGGATCTGAGGGAAGG - Intronic
1002247596 5:177896958-177896980 CATTAGGGGGATCTGAGGGAAGG + Intergenic
1002898632 6:1393174-1393196 CCTTGGGGTGTGCTGGGGGAGGG - Intronic
1003084917 6:3053501-3053523 CCTCCGGGGAGGCTGCAGGAGGG + Intergenic
1010757466 6:79683048-79683070 CGAGCGGGGGAGCTGGGGGAGGG + Intronic
1016428524 6:143959042-143959064 CCTGCGGATGAGCTGGGGGATGG - Intronic
1019575090 7:1733866-1733888 CCTTTGGGGGAGCTGAGGCCTGG - Intronic
1019925888 7:4191605-4191627 GCTTCGGGGGAGCAGCTGAAGGG - Intronic
1020013147 7:4817130-4817152 CCTTCTGGGGGGCTGAGGGAGGG - Intronic
1022104008 7:27185614-27185636 CCACCCGGGGAGCTGCGGGTGGG - Intergenic
1022830416 7:34059897-34059919 CCTCTGGGGGAGTTGCAGGATGG - Intronic
1023864341 7:44231808-44231830 CCTCCTGGGGACCTGGGGGATGG - Intronic
1026980947 7:74526305-74526327 CCCTCTGGGGAGCTGCGTGGGGG + Intronic
1030974277 7:116101681-116101703 CCTTGGGGGGAGTTGGGGCAGGG + Intronic
1034242983 7:149624181-149624203 CGCTGGGGGGAGCTGGGGGAGGG + Intergenic
1042591416 8:70402582-70402604 CCCTGGGGGGTGCTGGGGGAGGG - Intronic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1047247275 8:123156794-123156816 CCGGCGAGGGAGCTGCGGGATGG - Intergenic
1047487081 8:125341167-125341189 CCTTCTGCGATGCTGCGGGAGGG + Intronic
1049040863 8:140110916-140110938 GCTTTGGGGGAGCTGCTGCAGGG - Intronic
1049271262 8:141697473-141697495 CCTGCTGGGGATCTCCGGGAAGG + Intergenic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049800542 8:144515626-144515648 CCTTCAGGGGAGCTAGGGTAGGG + Intronic
1057814664 9:98285701-98285723 CTTTCAGAGGAGCTGCAGGAAGG + Intergenic
1059451124 9:114372069-114372091 CCTTCAGGGCAGCTGTGAGATGG + Intronic
1060154232 9:121308139-121308161 CCTTCAAGGGAGCTGTGGGTTGG - Intronic
1060838697 9:126777692-126777714 CCCTCCTGGGAGCTGGGGGAGGG + Intergenic
1061484651 9:130914216-130914238 CCCTCGGGAGGGCTGGGGGAGGG - Intronic
1062261723 9:135666247-135666269 CCTTCCCGGGAGCTGGTGGAGGG - Intronic
1062606431 9:137350739-137350761 CACTTGGAGGAGCTGCGGGAGGG - Intronic
1187583916 X:20639139-20639161 CCTTGGTGGGGGCTGAGGGAAGG - Intergenic
1189772417 X:44439406-44439428 TCCTCTGGGGAGCTGGGGGAAGG + Intergenic
1192657027 X:73003153-73003175 CCTTCCCGCGAGCTGGGGGACGG - Intergenic
1192665093 X:73079848-73079870 CCTTCCCGCGAGCTGGGGGACGG + Intergenic
1198518352 X:137429437-137429459 CCGTAGGGGGCGCTGCGGCAGGG - Intergenic
1199897457 X:152138065-152138087 GCTTCAGGGGAGCAGAGGGAAGG - Intronic
1200003065 X:153072078-153072100 CCTCCGGGGCACGTGCGGGAGGG + Intergenic
1200004658 X:153077931-153077953 CCTCCGGGGCACGTGCGGGAGGG - Intergenic