ID: 1089440668

View in Genome Browser
Species Human (GRCh38)
Location 11:118514105-118514127
Sequence CTGGAGACTCTGAGGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089440668 Original CRISPR CTGGAGACTCTGAGGGTACA AGG (reversed) Intronic
900103892 1:974119-974141 CTTGGGACTCTGAGGGAGCAGGG + Intronic
900642082 1:3692574-3692596 TGGGAGAGTCTGGGGGTACAAGG - Intronic
901529080 1:9842495-9842517 CTGGAGCCCCTGAGGTCACATGG - Intergenic
902981583 1:20127195-20127217 CTGCAGACTCTCAGGGTTCCAGG - Intergenic
904773115 1:32892107-32892129 CTGGAGAATCTGAAGGGCCAGGG + Intronic
905484968 1:38289202-38289224 CTGGAGTAGCTGAGGCTACAGGG - Intergenic
908085380 1:60626602-60626624 CTGAGGGCTCTGAGAGTACAGGG - Intergenic
908198136 1:61766284-61766306 CTGAACAATCTGAGGGTATATGG - Exonic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
913054720 1:115147768-115147790 ATGGAGACTCAGAGGGTAAGGGG + Intergenic
913184774 1:116360242-116360264 CTGGAAACTCTGGAGGAACAGGG + Intergenic
915600996 1:156923309-156923331 CTTGAGACTCTGAGTCTTCAAGG - Intronic
918248502 1:182681354-182681376 CTGTAGACTCTGATGGCAAATGG - Intronic
919790259 1:201285939-201285961 CCGCAGAGTCTGAGGGTAGAGGG - Intronic
921067169 1:211631284-211631306 CAGGAGACTTTCAGGGTGCAGGG + Intergenic
923045061 1:230349764-230349786 CTGGAGAATGTGAGGGGACAAGG + Intronic
1062771539 10:105128-105150 CTGGAGCCTGTGAGGGGAGAAGG + Intergenic
1062856367 10:781371-781393 CTGGGGCCTCTGTGGGTAAATGG + Intergenic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1065984174 10:30932971-30932993 CATGAGCCTCTGAGGGAACATGG + Intronic
1067433812 10:46263777-46263799 CTGGTGTCACTGAGGGTCCAGGG + Intergenic
1067655498 10:48188543-48188565 CTGGGGACTCTCAGAGGACAGGG - Intronic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1071350346 10:84734460-84734482 CTGGAGATACTGATGGTACCAGG - Intergenic
1071431798 10:85612416-85612438 CTGGAGGCTCAGATAGTACAGGG - Intronic
1071794741 10:88991893-88991915 CCGGAGCCTCTGAGAGTCCATGG + Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1075615612 10:123889144-123889166 CTGCAGACTCAGGGGTTACATGG - Intronic
1075870592 10:125770176-125770198 CTGGAAGCTCTGAGGGCACAAGG - Intronic
1078558946 11:12354138-12354160 CTGGGATCTCTGAAGGTACATGG - Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1082747497 11:56980985-56981007 CTGGAGAACCTGAGGTTCCAGGG - Intergenic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1086101696 11:83106896-83106918 TTGCAGACTCTGAGGGCCCATGG - Intergenic
1086821932 11:91445819-91445841 CTGGAGAGTCTGAGGTGACAAGG + Intergenic
1087458574 11:98419013-98419035 CTGGAAACTCTGTTGATACAAGG + Intergenic
1087771973 11:102220657-102220679 CTGGAGTCTCTGAGGTTGGAGGG + Intronic
1087920789 11:103864003-103864025 CAGGAGAATCTGAGAGTTCAAGG - Intergenic
1088927729 11:114319437-114319459 ATGGAGACTCTAAGGGGGCAAGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1089560935 11:119342774-119342796 CAGGACACTCTGGGGGTACTGGG - Intronic
1092579191 12:9820530-9820552 CTGGAGAGTCTGTGGGGACCAGG + Intergenic
1092659408 12:10722729-10722751 CTGGAGACGCTGACAGCACAGGG - Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1095482312 12:42649292-42649314 CTGGAGTCTCTGAGCCTACCTGG - Intergenic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1098583735 12:72132221-72132243 CTGGAGACTGTGAGGCTAGCTGG + Intronic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1100411193 12:94321683-94321705 CTGGAGAGTCTGTGGGGACCAGG - Intronic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1101451060 12:104779724-104779746 CTGCTGACTCTGAGGGCACCTGG - Intergenic
1101602320 12:106221469-106221491 CTGAAGACATTGAGGGTCCAGGG - Intergenic
1101928713 12:108994693-108994715 CTGGAGACTCTGAAGTCAGATGG - Intronic
1103166926 12:118778302-118778324 CTAGAGCCTCTGAGGGAACATGG + Intergenic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108691147 13:52860395-52860417 CTGGAGGCTCTCAGGGAAGAAGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111131722 13:83985606-83985628 AAGGAGACTCTGTTGGTACAGGG + Intergenic
1114670760 14:24409799-24409821 CTGGAGACTCTGGGGGTCACAGG - Exonic
1114991626 14:28296188-28296210 CTGGAGAGTCTGTGGGGACCAGG - Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1116102971 14:40465211-40465233 GGGAAGACTCTGTGGGTACATGG - Intergenic
1118816800 14:69319667-69319689 CTGGAGACTCTGGGAGCACAGGG + Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1121137275 14:91510175-91510197 CGGGAGACTCTGAGGGCCCCCGG + Intronic
1121744543 14:96278012-96278034 CTGGGGATTCTGAGGTTCCAGGG + Intergenic
1121832364 14:97063307-97063329 ATGGAGACACTGAGAGTCCAGGG - Intergenic
1122631219 14:103108643-103108665 CTTGAGGGTCTGAGGGTCCAAGG - Intronic
1122810383 14:104284810-104284832 CTGGTGACTGCGAGGGTGCAAGG + Intergenic
1122826567 14:104373680-104373702 GTCGAGTCTCTGAGGGTGCAGGG - Intergenic
1123934514 15:25187696-25187718 CTGGAGGCTCTGAGGGCATCTGG + Intergenic
1123936151 15:25195081-25195103 CTGGAGGCTCTGAGGGCATCTGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1130069494 15:80634612-80634634 CTGGAGACTGTGAGGGCACCAGG + Intergenic
1130303735 15:82699401-82699423 CTGGAGGCTCTGAGGGGAGGAGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1133236023 16:4387809-4387831 CTGGAAGCTCCGGGGGTACAGGG + Intronic
1133717098 16:8460240-8460262 GTGGAGATTTTGAGAGTACAGGG + Intergenic
1135134998 16:19880923-19880945 CTAGACACTCGGAGGGGACATGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137819445 16:51429786-51429808 CTGGAGACTCTTAGGGCAGGTGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1140839702 16:78827398-78827420 CTGGAGTCTCTGTGGCTCCAGGG + Intronic
1141505995 16:84479138-84479160 CAGGAGACTTTGAGGTAACATGG - Exonic
1143409031 17:6697358-6697380 CTGCAGACTCTGGGGCTGCATGG + Intronic
1143415336 17:6743950-6743972 CTAGAGAGTCTGAGGTTACTAGG + Intergenic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1144888386 17:18479029-18479051 GTGGAGCCTCTGAGGCAACAGGG + Intronic
1145143820 17:20465273-20465295 GTGGAGCCTCTGAGGCAACAGGG - Intronic
1145245818 17:21268691-21268713 CTGGAGATTCTGAGATTCCAGGG - Intergenic
1146905794 17:36617175-36617197 CTGGAGTCTCTGTGGGGCCAAGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147190123 17:38733592-38733614 CTGGAGACTTTTAGGTTATAAGG - Exonic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1150559295 17:66281017-66281039 CGGGTGACCCTGAGGTTACAGGG + Intergenic
1151203300 17:72485132-72485154 CAGGAAACTCTCAGGGTCCAGGG - Intergenic
1152122883 17:78429441-78429463 CTGGTGACCCTGAAGGTAAATGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1152799907 17:82326031-82326053 CTGGACGCTCTGAGTGTTCAGGG + Intronic
1154106519 18:11528131-11528153 CTGCAGACCCTGAGGGCTCAGGG - Intergenic
1154134748 18:11766469-11766491 CTGGGGACTCTGGGGGTGCTGGG - Intronic
1156296606 18:35797471-35797493 CTGGAAACTCTTAGAGGACAGGG + Intergenic
1156432507 18:37091581-37091603 CTTGAGTCTCAGTGGGTACATGG - Intronic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157555218 18:48609081-48609103 CTGTGGACTCTGAAGGTAGATGG - Intronic
1160246304 18:77162861-77162883 CTGGAGACACTGTGGGTGAAAGG + Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160953348 19:1678053-1678075 GGGGAGACTCTGGGGGGACACGG - Intergenic
1161021664 19:2014167-2014189 CTGGAGAGTCCCTGGGTACAGGG + Intronic
1161717858 19:5886868-5886890 CTGGGGACCCTGTGGGTACAGGG + Intronic
1162114512 19:8420614-8420636 CTGGAGGCTTTGAGGGTAAGAGG + Intronic
1162463379 19:10826452-10826474 CTGGAGACTCTCAGGGCTCTGGG + Intronic
1162573224 19:11484199-11484221 CTGCAGACTCTGATGCTAGAAGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165386352 19:35512693-35512715 CTGGGGACTCCGTGGGTCCACGG - Exonic
1166301491 19:41914113-41914135 CGGGCGAGTCTGAGGGGACATGG - Intronic
1167314385 19:48755290-48755312 CTGGAGCCCCTAAGGGTGCAAGG - Exonic
1167706176 19:51082516-51082538 CTGGAGACTCTGAGAAGAGATGG - Intronic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925272493 2:2622577-2622599 CTGGAGGCTTTGTGGGTATAGGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
929557138 2:42932444-42932466 CTGCAGACTCTGAGATTGCAGGG - Intergenic
929657223 2:43745915-43745937 CTGGAAAATGTGAAGGTACAAGG + Exonic
930419195 2:51129260-51129282 CTGGCACCTCTGATGGTACATGG - Intergenic
931642666 2:64395540-64395562 CTGAAGACACTGTGGGTCCATGG + Intergenic
931707621 2:64960401-64960423 CTGCACACTCTGAGGGGCCAAGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935319913 2:101876349-101876371 GTGGAGACTGTGACGGTACAAGG + Intronic
938016869 2:127874509-127874531 CTGGGGACTCTTGGGGAACAGGG - Intronic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941069941 2:160944582-160944604 GTGGAGACAGTGAGGGTAGATGG - Intergenic
943944802 2:194045146-194045168 CTAGATACAATGAGGGTACATGG - Intergenic
948360779 2:237418655-237418677 CTGGAGACTGTGATGGAACTCGG - Intergenic
1169791613 20:9415899-9415921 CTGGTGGCTGTGAGGGTGCAGGG - Intronic
1172850106 20:37955623-37955645 CTGGAGAATTTGAGGGGACACGG + Intergenic
1174004904 20:47402782-47402804 TCTGAGGCTCTGAGGGTACAAGG + Intergenic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1178719374 21:34994876-34994898 CTGAAGTCTCTGAGGGTGTACGG - Intronic
1178805330 21:35834531-35834553 CTGGAGCCTCAGAGAGTTCAGGG - Intronic
1179392868 21:41009925-41009947 CTGAAGAGTCTCAGGCTACACGG - Intergenic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179639098 21:42735506-42735528 CTGGAGGCTCTGAGGGGCCCTGG + Intronic
1180177056 21:46095982-46096004 CTGCAAGCTCTGAGGGGACAGGG + Intergenic
1181031158 22:20149403-20149425 CTGGAGATTCTCAGGTAACACGG - Exonic
1181403433 22:22665644-22665666 CTGGAGAATCTGTGGGGACTGGG - Intergenic
1181788996 22:25248429-25248451 CTGGAGCCTCTGATGACACATGG - Intergenic
1183752630 22:39730478-39730500 CTGCAGACTCTGAGGGGTCCTGG + Intergenic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
949317396 3:2772027-2772049 CTGGAGAGTGGGAGGCTACAAGG + Intronic
949602150 3:5611767-5611789 CTGGGGACTTTAAGGGAACATGG + Intergenic
950467924 3:13166462-13166484 CAGGAGACTCTGATGGCTCAGGG - Intergenic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
954315498 3:49799206-49799228 CTGGGGACTGTGGGGGCACAAGG - Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955859342 3:63310944-63310966 CAGGACACACTGAGAGTACAGGG - Intronic
956890932 3:73613472-73613494 CTGGGGAGTCTGGGAGTACAGGG + Intronic
956903354 3:73740109-73740131 CGGGAGACTGAGAGGCTACATGG + Intergenic
958991307 3:100848981-100849003 CTGGACATTCTAAGGATACAAGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961344274 3:126252360-126252382 CTGGAGTCTCTGAGCCTACTTGG + Intergenic
961348561 3:126282506-126282528 CTGGAGATTCTGAGGGTTTTAGG - Intergenic
961492343 3:127264584-127264606 CTGGAGCCTCTGAGGATACTCGG - Intergenic
962991431 3:140580883-140580905 CTGAAGACTCTGTGGGGAGAAGG + Intergenic
963651131 3:147981543-147981565 CCGTAGACACTGAAGGTACAAGG - Intergenic
965682367 3:171264637-171264659 CTGGAGAGTGTGAGGGAACCCGG - Intronic
966862812 3:184239874-184239896 CTGGAGACACTGTGGGGACCTGG + Exonic
968453970 4:688093-688115 GTGGAGTGTCTGAGGGTGCAGGG - Intronic
969449021 4:7262497-7262519 CTGGAAGCTCTGAGAGGACAGGG - Intronic
972115548 4:35628822-35628844 CTGGAGACCATGAGGCTACCTGG + Intergenic
973077134 4:45943266-45943288 CTGCTAACTCGGAGGGTACATGG - Intergenic
974154458 4:58053135-58053157 CTTGAAACTCTGAGGGCACTGGG - Intergenic
974500825 4:62699807-62699829 ATGGAGACTAAGTGGGTACAAGG + Intergenic
977846555 4:101773811-101773833 CTGGAGGGTCTGAGGGGTCAGGG + Intronic
979597523 4:122550705-122550727 TTGTAGACTCAGGGGGTACATGG - Intergenic
981824517 4:148924890-148924912 GTGGAGACAGTGAGGGTAGAAGG - Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
983873764 4:172852310-172852332 ATGAACACTCTGAGGCTACAGGG - Intronic
984077545 4:175202035-175202057 CTGTAAACTCTGTGGGCACAGGG + Intergenic
985507229 5:290301-290323 CTGGAGACTCTCAACGTCCATGG + Intronic
987844722 5:23268289-23268311 CTGGAGTCTCTGAGCCTACCCGG - Intergenic
990969057 5:61483157-61483179 GTGGGGACTCTGTGGGCACAGGG + Intronic
991579091 5:68135505-68135527 TTGGAGACCCTGAATGTACAGGG + Intergenic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
992028338 5:72693680-72693702 CTGGAGACTCTCAGGCTCCACGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994451485 5:99950227-99950249 CCTGAGGCTCTGAGAGTACAAGG - Intergenic
996774072 5:127115940-127115962 CTGTAGGCTCTGAGGATTCAAGG - Intergenic
998416123 5:141947328-141947350 CTTGAGACTCTGAGGCTATAAGG + Intronic
998661093 5:144238554-144238576 CTGGAGACTGTGATGGTAACCGG + Intronic
1000245677 5:159446854-159446876 CTGGAGACTCTGAGGGCAGGTGG - Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001089346 5:168725965-168725987 CTGGGGACTCTCATGGCACAGGG + Intronic
1001420260 5:171581112-171581134 CTGGAGACTCCCAGGGTCCCGGG - Intergenic
1002300760 5:178256265-178256287 CTGGGGTCTCTGTGGGGACAGGG + Intronic
1005799971 6:29410607-29410629 CTGGAGAGTCTGTGGGACCAAGG + Intronic
1005838297 6:29723985-29724007 CCGGAGACTCTGAGGGACCCGGG - Intronic
1007289516 6:40774826-40774848 GTGGAGACACTGAGGGTTCGGGG - Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1011307671 6:85946709-85946731 CTGTAGAATATGTGGGTACATGG + Intergenic
1011640678 6:89413357-89413379 CAGGAGACTCTCAGGGCCCAAGG + Intergenic
1011795659 6:90948630-90948652 CTGGTGCCTGTGACGGTACATGG + Intergenic
1011839434 6:91478173-91478195 CTGGGGACTCTGAAGATCCAGGG - Intergenic
1015795150 6:137003947-137003969 CTGGGAATTCTGGGGGTACAAGG - Intronic
1015845482 6:137515973-137515995 CTGGAGTCTCTGAGCCTACTCGG - Intergenic
1016686687 6:146889900-146889922 ATGGGGCCTCTGAGGGTTCATGG + Intergenic
1017755739 6:157527485-157527507 GTGGAGACTCTGAGGCTGCATGG - Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019192688 6:170262381-170262403 CTGGAGTCTCTGAGGGGGCGCGG - Intergenic
1020883450 7:13793092-13793114 CTGGAGACTCTGGGGATGCCAGG - Intergenic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1024620585 7:51154077-51154099 TTGGTGACTCTCAGGGTACTTGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1028354058 7:89885316-89885338 GTGGGGACACTGAGGGTAGATGG - Intergenic
1029915294 7:104202736-104202758 CTTCAGAATCTGAGTGTACAAGG - Intronic
1031391360 7:121218693-121218715 CTGGGGACTGTCAGGGGACATGG + Intronic
1032200774 7:129821273-129821295 CTGCAGACTCTAAGAGGACATGG + Intergenic
1033462826 7:141562885-141562907 CTGGAGACTGTGTGCCTACAAGG + Intronic
1034817771 7:154188185-154188207 CTAGAGACTGTGAGTGTACTTGG + Intronic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1038714677 8:29981089-29981111 CTGGAGATTCTGAGGGGGCTGGG + Intergenic
1045480434 8:102587221-102587243 CTTGAGACTCTGGAGGTCCATGG + Intergenic
1045582715 8:103499084-103499106 CTGGAGGCTGTGAGGGTGAAAGG - Intergenic
1047182062 8:122598136-122598158 CTGGAGTCTTTGAGGCTGCAAGG - Intergenic
1049129359 8:140823675-140823697 CTGGAGACTATGGGGGTCAAAGG - Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050263785 9:3869037-3869059 CTGGATACTCTGAGAGGGCAAGG + Intronic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056116869 9:83449095-83449117 CTGGAGGCTCTCAGGGGCCAGGG + Intronic
1058534984 9:105949880-105949902 CTGGAGAGTCTGTGGGACCAGGG - Intergenic
1059193654 9:112350207-112350229 TTGGGGACTCAGAGGGTAAAGGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060433451 9:123570842-123570864 CTCGAGAGTCTGAGGGTTCTGGG + Intronic
1061036797 9:128118726-128118748 ATGGAGAATGTAAGGGTACAGGG + Intergenic
1062436908 9:136550453-136550475 CTGGAGACACTGAGTAGACAGGG - Intergenic
1062469455 9:136696211-136696233 CCGGAGACACTCAGGGCACATGG - Intergenic
1187212192 X:17242741-17242763 TTAGAGACTCTGAGGGACCATGG + Intergenic
1188046794 X:25434403-25434425 AAGGACACTCTGAGGGTACTTGG + Intergenic
1188607450 X:32049527-32049549 ATGGAGACTCTGAAGGGATAAGG - Intronic
1188791519 X:34412850-34412872 TTGGAGAATCTGAGGTGACAGGG + Intergenic
1188880626 X:35487378-35487400 CTGGAAAGTCTGAGGGGACTAGG + Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190133151 X:47769175-47769197 CTGGAAAATCTGAGGCGACAAGG + Intergenic
1190237320 X:48626403-48626425 CTGGAGACTGAGAGGCCACATGG - Intergenic
1191883633 X:65866523-65866545 CTGAAAACTCTGAGTGTTCAGGG + Intergenic
1192103943 X:68294974-68294996 CGGGAGACACTGAGGATCCAAGG + Intronic
1193340623 X:80345250-80345272 CTGGAATCTCTGATGATACATGG - Intronic
1193459648 X:81775369-81775391 CTAGATACAATGAGGGTACAGGG + Intergenic
1194055658 X:89128217-89128239 TTGGAGAATCTGAGCCTACAGGG - Intergenic
1194201468 X:90957873-90957895 CTGGAGATTCTGAGGTAACTAGG + Intergenic
1196176675 X:112646176-112646198 CTGAAGACTCTGGTGGGACAGGG + Intronic
1199307086 X:146279548-146279570 TTGGAGACTCTGAGGCAACTGGG - Intergenic
1200054191 X:153450190-153450212 TTGCAGCCTCTGAGGGTCCATGG - Intronic
1200547308 Y:4533328-4533350 CTGGAGATTCTGAGGTAACTAGG + Intergenic