ID: 1089441766

View in Genome Browser
Species Human (GRCh38)
Location 11:118523482-118523504
Sequence CAGGTTCAGGACTCTGTCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089441766_1089441769 -6 Left 1089441766 11:118523482-118523504 CCCAAGACAGAGTCCTGAACCTG 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1089441769 11:118523499-118523521 AACCTGTTAAATTAAGTCATTGG 0: 1
1: 0
2: 1
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089441766 Original CRISPR CAGGTTCAGGACTCTGTCTT GGG (reversed) Exonic
901082437 1:6591224-6591246 CACCATCAGGACCCTGTCTTTGG - Exonic
906531762 1:46527688-46527710 CAGGGTCAGGGCTCAGTCTATGG + Intergenic
907248234 1:53121494-53121516 CAGCTTCAGGACTCTGCTTTCGG + Intronic
908842259 1:68292036-68292058 CAGGTTCAAGGCTCTGTCTGGGG - Intergenic
909299839 1:73998435-73998457 GAGTTCCATGACTCTGTCTTGGG + Intergenic
910201138 1:84700227-84700249 CAGTTTCACTACTCTGTCCTAGG - Intergenic
910320867 1:85942573-85942595 GACATTCAGGACTGTGTCTTTGG - Intronic
915738169 1:158097840-158097862 CAGCTTCAGGACTGGGTCCTGGG - Intronic
917087301 1:171316827-171316849 CAAGTTCATGAATCTGCCTTAGG + Intronic
917891659 1:179444520-179444542 CATGTTCAGGACTTGGACTTGGG + Intronic
920513909 1:206570106-206570128 CAGATTTGAGACTCTGTCTTGGG - Intronic
921575890 1:216834256-216834278 CAGGTGCAAGACACTGTATTTGG - Intronic
924137076 1:240979711-240979733 AAGGTTCAGGTTTCTGTCCTAGG - Intronic
1067249009 10:44571657-44571679 CAGGTCCAGGTCTCAGTCTGTGG + Intergenic
1067655128 10:48186154-48186176 CAGCTTCAGGGCTCTGCCTGGGG - Intronic
1069813897 10:71181309-71181331 CAGTCTCAGCACTCTGTCTGAGG - Intergenic
1073810261 10:107144686-107144708 CAGGTTCAGCACTGTCTCATAGG + Intronic
1073901964 10:108232816-108232838 CAGGATCAGGAAACTATCTTGGG + Intergenic
1075147682 10:119896246-119896268 CAGGTACAGAGCTCAGTCTTGGG - Intronic
1075401439 10:122163953-122163975 CAGGTTCAGGTCGCTGGCTGGGG - Intronic
1076835473 10:133018773-133018795 CACGTTCTGGACTCTGGCTCTGG - Intergenic
1077458811 11:2698687-2698709 CAGGGTCTGGAGTCTGTCTTTGG - Intronic
1078132762 11:8626312-8626334 CAGGTTCAAGACACTGATTTTGG - Intronic
1079396224 11:20066211-20066233 CATGTTCACGGCTCTATCTTAGG + Intronic
1080072032 11:28100735-28100757 CCTTTTTAGGACTCTGTCTTTGG + Intronic
1080799454 11:35596626-35596648 CTGGTCCTGGACTCTGTTTTTGG + Intergenic
1082755535 11:57072312-57072334 CTGGTTCAGGTCTCTCTCCTTGG + Intergenic
1084183210 11:67456660-67456682 CAGGTTGAGGACCCTGGCTCGGG + Intronic
1086208647 11:84291946-84291968 CAGGTTCTAAACTTTGTCTTAGG + Intronic
1087180894 11:95141516-95141538 CAGGTACATGACTATGTTTTTGG - Intergenic
1087367481 11:97239308-97239330 CAGTTTCAGGATTTTGTCTGAGG - Intergenic
1088836097 11:113578981-113579003 CAGGCTCACCAATCTGTCTTAGG + Intergenic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1089767885 11:120781768-120781790 CAGGTTCAGGACTTTGGGCTAGG + Intronic
1095848329 12:46772013-46772035 CCTGTTCAGGACTCTTTCTCTGG - Intronic
1096238788 12:49948349-49948371 CAAGTTCAGGACTGAGTCTCAGG - Intergenic
1098295636 12:69001329-69001351 CAGGTACAGGACTCTCTCTTAGG + Intergenic
1098373356 12:69783688-69783710 CAAGCACAGGACTCTATCTTTGG - Intronic
1098627233 12:72687102-72687124 CAGATTCAGGAATCTATCTCAGG - Intergenic
1102650558 12:114439460-114439482 CAGGTTGAGCACCCTGGCTTCGG - Intergenic
1104539177 12:129646328-129646350 GAGGATAAGGACTCTGTCTAAGG + Intronic
1105917091 13:24926701-24926723 CAGTTACGGGACCCTGTCTTAGG + Intergenic
1106605902 13:31228530-31228552 CTGTTCCAGGCCTCTGTCTTTGG + Intronic
1106750741 13:32763942-32763964 AAGGTCCAGGCCTCTGTCCTGGG - Intronic
1106964878 13:35051202-35051224 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
1107413015 13:40174954-40174976 CAGTATCAAGCCTCTGTCTTGGG + Intergenic
1107922207 13:45220799-45220821 CTCCTTCAGGGCTCTGTCTTTGG + Intronic
1108494896 13:51015723-51015745 CAGGTTCAGAACTCAGGCTGAGG - Intergenic
1112164305 13:96901306-96901328 CACATTCAGAAATCTGTCTTGGG - Intergenic
1114073724 14:19137628-19137650 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1114088540 14:19262357-19262379 CAGGTTCAGGGTTCTTTCTTGGG - Intergenic
1114649524 14:24275466-24275488 CAGGTTCAGGCCTCTGGCAATGG - Intergenic
1115647596 14:35380297-35380319 CAAGAACAAGACTCTGTCTTGGG + Intergenic
1119607239 14:76030691-76030713 AAGGTTCAGGATACTGTTTTCGG + Intronic
1120701656 14:87705178-87705200 CAGGTTCCTGACTCTGTGCTAGG + Intergenic
1120923193 14:89773335-89773357 CTGGTTCATGGCTCTGTCTGGGG + Intergenic
1121616777 14:95319113-95319135 CAGGATCAGGACTCTAACTGGGG - Intronic
1121716411 14:96079102-96079124 CAGGTCCAGCTCTCTGCCTTGGG + Intronic
1122160994 14:99783807-99783829 CAGGTTTAGGCCTTTGTCCTGGG - Intronic
1123221897 14:106865362-106865384 CAGGTTCAAGGCTCAGCCTTAGG - Intergenic
1124690131 15:31814969-31814991 GAGCTTCAGGACTCTGCCCTAGG - Intronic
1125616071 15:41014669-41014691 CAGTTTCAGCACTAAGTCTTAGG - Intronic
1128676362 15:69611967-69611989 CAGGTTCAGGATGCTGCCTTAGG - Intergenic
1128718179 15:69925498-69925520 CAGGCTCAGGGCCTTGTCTTTGG + Intergenic
1129381965 15:75173679-75173701 CAAGTGCAGGGCTCTGTCTGTGG - Intergenic
1129663553 15:77566728-77566750 CAGGTTTGGGACTGTGTCTGAGG + Intergenic
1129844329 15:78761317-78761339 CTGGCTGAGGACTCTGTCCTAGG + Intronic
1131112554 15:89774623-89774645 CAGGTTAAGGGCTCTGCCTAAGG + Intronic
1131305981 15:91243580-91243602 CAGGTTCCTGGCTGTGTCTTTGG - Intronic
1137224139 16:46486135-46486157 TAGGTTCAGGGCTTTTTCTTTGG - Intergenic
1137982820 16:53084345-53084367 CCAGTTCAGGACTCTTTCTTTGG - Intronic
1140293031 16:73681666-73681688 CAGGATCAGGTGCCTGTCTTTGG - Intergenic
1143388571 17:6546622-6546644 CAGGGTCAGGGCTTAGTCTTTGG - Intronic
1146476488 17:33166711-33166733 CAGGTTCTGGGCTCTGCCTGTGG - Intronic
1150511842 17:65761383-65761405 CAGGTACATGACACTGCCTTTGG + Intronic
1151454164 17:74216163-74216185 GAGGTTCAGGAGTGTGTCTCAGG + Intronic
1153264237 18:3253582-3253604 CAGATTCGTGACCCTGTCTTAGG + Intronic
1153293122 18:3520882-3520904 CACCTTCTGGACTCTGCCTTTGG + Intronic
1153707114 18:7757284-7757306 AAGGGTCAGGATTCTGTGTTGGG + Intronic
1154116757 18:11618262-11618284 CAGGAGTAGCACTCTGTCTTGGG - Intergenic
1157720580 18:49920779-49920801 GATGTTCAGGACTCAGTCTCAGG + Intronic
1160299145 18:77663861-77663883 CAGGACAAGGACTCTGTCCTTGG - Intergenic
1162582758 19:11540563-11540585 CAGCTCCAGGGCTCTGTCTCTGG - Intronic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
926709021 2:15861176-15861198 CCAGTTCAGGTTTCTGTCTTTGG - Intergenic
927415875 2:22879943-22879965 GAGTTTCAGGACTCAGTCTGGGG - Intergenic
927935043 2:27071643-27071665 CCGGTCCAGGTCTCTGACTTCGG - Exonic
928277594 2:29917152-29917174 CAGGTTTAGGAAGCTATCTTTGG + Intronic
930015080 2:46964536-46964558 ATGGTTCAGCACTCTGTCTGGGG + Intronic
930902909 2:56529711-56529733 CAGGTACAGTATTCTGACTTTGG + Intergenic
931928782 2:67105586-67105608 CATGTTCTGGACTATGTGTTTGG - Intergenic
934987004 2:98894774-98894796 TAGGTGCAGGTCACTGTCTTCGG - Intronic
937508157 2:122560520-122560542 CAGCTTCAGAAAACTGTCTTTGG - Intergenic
937877889 2:126839209-126839231 CAGGCACAGGACTCAGTCCTGGG + Intergenic
938487663 2:131729013-131729035 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
939705812 2:145451478-145451500 CTGCTTCATGACTCTGTCTAAGG - Intergenic
942687707 2:178551064-178551086 CAGTTACAGGACTCAGTCCTGGG - Exonic
943332424 2:186575500-186575522 CAGACACAGGACTCTGACTTAGG + Intergenic
943725815 2:191250330-191250352 CAGGTTCAGAACCCTGACTGAGG + Intronic
944984646 2:205161597-205161619 ATGATTCAGGATTCTGTCTTAGG + Intronic
945974778 2:216261785-216261807 GAAGTCCAGGGCTCTGTCTTTGG - Intronic
946656144 2:221950119-221950141 CAGTTTCTGGACCCTGCCTTGGG - Intergenic
946775160 2:223130415-223130437 CAGATCCAGGATTCTCTCTTGGG + Intronic
948613133 2:239182062-239182084 CAGATTCAGGACTCTGCCCTGGG + Intronic
1169030115 20:2400357-2400379 CAGGTTCTGGTCTGTGTCGTGGG - Exonic
1169148481 20:3270365-3270387 CAGATACAGCACTCTGTCTGTGG - Intronic
1170434226 20:16308581-16308603 CAGGTGAAGGCCTATGTCTTGGG - Intronic
1170697171 20:18669465-18669487 CATGTGCAGGATTCTGTCATCGG + Intronic
1172055620 20:32152397-32152419 CAGCTTCAGGTTTCTGGCTTGGG - Intronic
1172939397 20:38644254-38644276 CTGGTTCTGGGCTCTGTCTTAGG - Intronic
1173566834 20:44045873-44045895 CAGCTTTAGAACTCTGTATTAGG - Intronic
1175026981 20:55913111-55913133 CAGTTTGAGGGCTCTGTTTTAGG + Intergenic
1175322281 20:58097550-58097572 CTCGTTCAGGACACTGCCTTTGG + Intergenic
1176044844 20:63087207-63087229 CAGGTTCATGACCCTGTCTGTGG + Intergenic
1176676843 21:9786653-9786675 CAGGTGCAGGACGCTGTATGTGG - Intergenic
1179038933 21:37784549-37784571 CAGGTTGAGGTATCTGTCCTGGG - Intronic
1179106705 21:38406923-38406945 CAGGTTGAGGACTTTGTCTCTGG - Intronic
1180492171 22:15859980-15860002 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1181693379 22:24579233-24579255 CAGGTCCAGCGCTCAGTCTTGGG - Intronic
1182643828 22:31791229-31791251 CAGGTTCAGGACTCCATCTAGGG + Intronic
1183077608 22:35436732-35436754 CTGGGTCAGGACCCTGTCCTAGG + Intergenic
1183472782 22:38018486-38018508 CAGGGTCAGGCCTCAGGCTTAGG + Intronic
1184637390 22:45844374-45844396 CAGCTTCATGCCTCTGTCATGGG + Exonic
1184991660 22:48174438-48174460 CAGGTTAAGAACTCCTTCTTTGG - Intergenic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
953387247 3:42513598-42513620 CAGGTTCAGGTTTCAGTCTTGGG + Intronic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
955988469 3:64599954-64599976 CATCTTCAGGGCTCTGTCTCAGG - Intronic
960339126 3:116453853-116453875 CAGGCTCAGGAAGTTGTCTTAGG + Intronic
961314682 3:126026460-126026482 CAGGTGCAGGCCACTGTCGTGGG - Exonic
961757768 3:129140127-129140149 CTGGTGCAGGATTCTGCCTTTGG - Intronic
966982400 3:185150254-185150276 AAGCTTCAGGACTCTATCTGTGG + Intronic
967126809 3:186431312-186431334 CAGGATGAGGATTCCGTCTTTGG - Intergenic
968994711 4:3938325-3938347 CAGGTGCAGGACTATGCCTCAGG + Intergenic
971410312 4:26364060-26364082 CAGATTCAGAACTCTCTTTTAGG + Intronic
971444690 4:26730875-26730897 CAGGCTCTGGAAGCTGTCTTAGG + Intronic
971981032 4:33750680-33750702 CAGATCAAGAACTCTGTCTTGGG - Intergenic
975414898 4:74094891-74094913 TAGGATGAGGACTTTGTCTTAGG + Intergenic
981281116 4:142960158-142960180 CAGGTTTTGGAGTGTGTCTTGGG - Intergenic
982341692 4:154306590-154306612 CTGACTCAGCACTCTGTCTTTGG - Intronic
985398696 4:189572130-189572152 CAGGTGCAGGACGCTGTATGTGG + Intergenic
988567495 5:32330858-32330880 CAAGTTCAGGCATCTGACTTAGG + Intergenic
990689302 5:58345693-58345715 CTGTTTCAGGCCTCTGTCCTGGG + Intergenic
990935490 5:61143710-61143732 AAGGCTCAGGAGTCAGTCTTAGG - Intronic
997228013 5:132223982-132224004 CAGGTTAAGGACTTTATCATGGG + Intronic
997774905 5:136594664-136594686 CTGCTTCAGGCCTCTCTCTTTGG + Intergenic
998543594 5:143006462-143006484 TTGGTTCAGGAATCGGTCTTTGG + Intronic
998910097 5:146950380-146950402 CAGGCTCTGTGCTCTGTCTTTGG - Intronic
1000409666 5:160924836-160924858 CAGGTCCAGAGCTCTGTCTTGGG + Intergenic
1000479351 5:161752237-161752259 TACTTTCAAGACTCTGTCTTTGG + Intergenic
1002836946 6:872957-872979 CACGGCCAGGACTCTGTCTGCGG + Intergenic
1003203946 6:3990366-3990388 CCGTTTCAGGCCTCTGTCCTTGG + Intergenic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1005370606 6:25128582-25128604 CAGCTTTGGGACTCTGTCTCTGG - Intergenic
1005469438 6:26147654-26147676 AAAGTTCTGGCCTCTGTCTTTGG - Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007297465 6:40836493-40836515 CAGGTTATGGCTTCTGTCTTTGG - Intergenic
1011886281 6:92099771-92099793 CTGTTTCAGGATCCTGTCTTGGG + Intergenic
1012425486 6:99109555-99109577 CAGGTTTTGGTTTCTGTCTTGGG + Intergenic
1014016041 6:116531216-116531238 CAGGTTAAAGACTCTCTTTTTGG + Intronic
1016372736 6:143391729-143391751 CTATTTCAGGACTCTCTCTTTGG + Intergenic
1016688218 6:146905532-146905554 AAGGTTCAGGCCTCTGGCTAAGG - Intergenic
1018516345 6:164583980-164584002 CAAGTTCAGGATTCTCTCCTTGG + Intergenic
1019665818 7:2251970-2251992 CAGGTTTAGGGCTCTGACATGGG - Exonic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1021986377 7:26101865-26101887 CACGTGCAGGACTCTGTGCTGGG - Intergenic
1022650097 7:32266716-32266738 CTGGTTCAGGTCTCTGTTTAAGG - Intronic
1026877462 7:73887682-73887704 CAGGGTCAGGGCTCAGTCTGGGG + Intergenic
1031053006 7:116964280-116964302 CAGTTTCTGGACTCTGTCTTGGG + Intronic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1034622740 7:152468843-152468865 GAGGTTGAGGACTCTGTGGTTGG + Intergenic
1035038108 7:155908454-155908476 CACGTTCAGGAATCTGGCATTGG + Intergenic
1036740469 8:11356809-11356831 TAGGTTCAGGACTCTGGCCAAGG - Intergenic
1037305732 8:17501622-17501644 CAGCTTCATGATTCAGTCTTGGG - Intronic
1037734596 8:21556146-21556168 CAGGTTAAGGAACATGTCTTTGG - Intergenic
1038210795 8:25517589-25517611 CAGTGTCAGCACTCTGTCTAAGG + Intergenic
1043507233 8:80914612-80914634 CAGGTGCATGACTGTGACTTGGG + Intergenic
1044867477 8:96586426-96586448 CAGGCTCAGGCCTGGGTCTTGGG + Intronic
1049465315 8:142748717-142748739 CAGGATCAGGGCTTAGTCTTTGG - Intergenic
1052691147 9:31818395-31818417 CATGCTAAGGAATCTGTCTTTGG - Intergenic
1055098683 9:72440731-72440753 CAGTTTGAGAACTCTATCTTTGG - Intergenic
1055513985 9:77019309-77019331 CAGCTCCAGCACTCAGTCTTTGG + Intergenic
1056863088 9:90205219-90205241 CAGGTCTAAGATTCTGTCTTGGG + Intergenic
1057604998 9:96492725-96492747 CAAGAGCAAGACTCTGTCTTTGG + Intronic
1057696644 9:97327754-97327776 CAGGGTCCTAACTCTGTCTTTGG - Intronic
1059166200 9:112078577-112078599 CAGTCTCCGGGCTCTGTCTTCGG - Exonic
1059718021 9:116931617-116931639 AAGGTACTGGACACTGTCTTAGG + Intronic
1060521137 9:124294793-124294815 CAGGTTCAGGCTTGTGTGTTAGG + Intronic
1192024439 X:67433795-67433817 CAGATTCAGGACTCAGACTCTGG + Intergenic
1193312247 X:80023068-80023090 GATGTTGAGGGCTCTGTCTTAGG - Exonic
1194751293 X:97687239-97687261 CACATTCAGGACTCTGTATTTGG + Intergenic
1196221408 X:113115347-113115369 CAGGTTTAGGTGCCTGTCTTTGG - Intergenic
1200228946 X:154434527-154434549 CAGGGTCAGGTCTGTGTTTTGGG + Intronic
1201521019 Y:14873771-14873793 CAGGTATTGGACCCTGTCTTAGG - Intergenic
1201777529 Y:17682716-17682738 CAGGTTCAAGACACTTTTTTTGG - Intergenic
1201824029 Y:18223276-18223298 CAGGTTCAAGACACTTTTTTTGG + Intergenic