ID: 1089442499

View in Genome Browser
Species Human (GRCh38)
Location 11:118529013-118529035
Sequence CCTACTATGTGGCAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089442495_1089442499 5 Left 1089442495 11:118528985-118529007 CCATTGATTAAGGAACAGTTAAT 0: 1
1: 0
2: 2
3: 11
4: 189
Right 1089442499 11:118529013-118529035 CCTACTATGTGGCAGTAGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089442499 Original CRISPR CCTACTATGTGGCAGTAGGC TGG Intronic
900180911 1:1310558-1310580 CCTACTATGTGGCCTTGGACGGG - Intronic
901054321 1:6441693-6441715 CCTGCTATGAGGCAATAGGCAGG + Intronic
901655015 1:10764334-10764356 CCTACTATGTGCCAGGCGGCAGG + Intronic
901681748 1:10916788-10916810 CCTACTATGTGCCAGGTGCCAGG - Intergenic
902479987 1:16706641-16706663 CCTGCTTTGAGGCAATAGGCAGG - Intergenic
904310412 1:29625726-29625748 CCAGCTATGTGACATTAGGCAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG + Intergenic
913099370 1:115549209-115549231 CAAAGTGTGTGGCAGTAGGCTGG - Intergenic
913158159 1:116120670-116120692 CCTACTATGTAGCAGGTGCCAGG - Intronic
920418797 1:205816150-205816172 CCTACTATGTGCCAGGAGCTGGG - Intergenic
1063112936 10:3052653-3052675 CCTAATATGGGGGAGGAGGCGGG + Intergenic
1067493600 10:46740221-46740243 CGTACAATGTGGGAATAGGCTGG - Intergenic
1067601059 10:47600183-47600205 CGTACAATGTGGGAATAGGCTGG + Intergenic
1068633418 10:59321918-59321940 CCTTCTTTGGGGCAGTGGGCTGG - Intronic
1069781163 10:70956569-70956591 CCTACCATATGACAGCAGGCTGG + Intergenic
1071652603 10:87408055-87408077 CGTACAATGTGGGAATAGGCTGG + Intergenic
1072990339 10:100186508-100186530 CCTATTATGTGCCAGAATGCTGG + Exonic
1073562144 10:104506219-104506241 CCTGCTCTGTGTCAGTGGGCAGG - Intergenic
1076801523 10:132832917-132832939 CCTGCTATGTGCCAGTATCCTGG - Intronic
1087757393 11:102069198-102069220 GCTACTCTGTGGCAATAGGGAGG + Intronic
1089442499 11:118529013-118529035 CCTACTATGTGGCAGTAGGCTGG + Intronic
1090846708 11:130535657-130535679 CCTGTTAGGTGGCAGTTGGCTGG - Intergenic
1092291398 12:7161487-7161509 GCTACTTTGTGGCAGTCTGCAGG - Intergenic
1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG + Intergenic
1093882977 12:24426705-24426727 TGTACTATGGGGCAGTACGCTGG - Intergenic
1098241555 12:68472541-68472563 CCTTCCATGTGGTAGTAGGATGG - Intergenic
1101529328 12:105559829-105559851 CCTGATATGTGGCAGTAGGAAGG - Intergenic
1102214395 12:111150132-111150154 CCTACTATGTGCCAGGGCGCTGG - Intronic
1107768523 13:43764078-43764100 CCTATTAAGCTGCAGTAGGCAGG - Intronic
1108454946 13:50603981-50604003 CCGACTATGTGACTTTAGGCAGG - Intronic
1112650896 13:101396964-101396986 CCTACTATGTGTCAGAATGCTGG + Intronic
1125071749 15:35562984-35563006 CCTTCTATGTTGCAGTACCCAGG + Intergenic
1125489741 15:40137543-40137565 CTTAAGATGTGGCTGTAGGCTGG + Intergenic
1125583074 15:40801152-40801174 CCTACTATGTGCCAGTCACCAGG + Intronic
1125737255 15:41935353-41935375 CCTACTATGTGTCAGGTGCCAGG - Intronic
1126890789 15:53202033-53202055 GCTACTATGTGCCAGAATGCAGG - Intergenic
1127069800 15:55277787-55277809 TCAACTATGGGTCAGTAGGCTGG + Intronic
1129330620 15:74825458-74825480 CCTTCTCTCTGGCAGCAGGCAGG + Exonic
1134326663 16:13213869-13213891 CCTACTATGTGCCAGAGGACTGG + Intronic
1137612352 16:49827223-49827245 CCTGCTCTGTGGCTGGAGGCTGG - Intronic
1138068047 16:53962443-53962465 CCTACTAGGAAACAGTAGGCTGG + Intronic
1139397796 16:66654365-66654387 CCTGCCATGTGACAGGAGGCAGG - Intronic
1139684601 16:68593130-68593152 CCTACTATGTGCCAGTATTGGGG - Intergenic
1141639142 16:85331019-85331041 CCTGCTATGTTGCTTTAGGCTGG + Intergenic
1144780963 17:17808199-17808221 CTCCCTAGGTGGCAGTAGGCAGG + Intronic
1144920610 17:18760961-18760983 CCTTGTATGTGGCATTAGGTAGG + Intronic
1148987060 17:51632276-51632298 CCTACCATGTGTCAGTTAGCTGG - Intronic
1151455574 17:74223748-74223770 CCCACTACCTGGCAGCAGGCTGG + Intronic
1155440597 18:25857880-25857902 CCTACTTTGTAGCAGTTGTCTGG - Intergenic
1157490150 18:48117497-48117519 CCTGCTATGTGACCTTAGGCAGG + Intronic
1202714024 1_KI270714v1_random:32547-32569 CCTGCTTTGAGGCAATAGGCAGG - Intergenic
933776668 2:85775238-85775260 CCTAGTATGTGCCAGAAGACAGG - Intronic
934742230 2:96732709-96732731 CCTAGTATCTGGCTGTTGGCAGG - Intronic
937914938 2:127094352-127094374 CCTACTATGTGCCAGAAGCCAGG + Intronic
938044180 2:128101802-128101824 CCTTCTATGTGGAACTAGGAGGG - Intronic
941103174 2:161321246-161321268 CTTAAAATGTGGCAGTAGACAGG + Intronic
942587830 2:177503912-177503934 TCTAATATCTGGCAGTAGGGAGG - Intronic
943386445 2:187208454-187208476 CATTCTCTGTGGCTGTAGGCAGG - Intergenic
947489185 2:230579158-230579180 TCTACCATGTGGCAGTCTGCTGG + Intergenic
1170658588 20:18314907-18314929 CGTAATAAGTAGCAGTAGGCTGG + Intronic
1172042651 20:32056875-32056897 CCTACTATGTGCCAGGTGCCAGG - Intronic
1178163666 21:29947296-29947318 CCTACTATGTGTCAGAAGTCGGG - Intergenic
1179467200 21:41583735-41583757 CCTGCTGTGGGGCAGGAGGCAGG + Intergenic
1180192308 21:46171534-46171556 CCTCCCACGTGGCAGGAGGCCGG - Intronic
1182806725 22:33078388-33078410 CCTACTATGTGCCAGGACCCAGG + Intergenic
953235240 3:41100810-41100832 CTTACCATGTGGCCTTAGGCAGG - Intergenic
955986046 3:64575103-64575125 TCTACTATGTGGCATCTGGCAGG - Intronic
956621416 3:71224650-71224672 CCTACTATGTGTCACTGTGCTGG - Intronic
961073040 3:123954133-123954155 CCTACTTTTTGTCTGTAGGCAGG - Intronic
962395505 3:135012298-135012320 GCTGCCATGTGGCAGTGGGCTGG + Intronic
967835247 3:193956924-193956946 CCTACTATATGGCTTGAGGCTGG + Intergenic
970683495 4:18537887-18537909 CCCACTATGTGCCAATAGCCTGG - Intergenic
988713076 5:33797980-33798002 CCTACCAAGAGGCAGTAGGATGG - Intronic
993111923 5:83668107-83668129 CCTACTATGTGCCAGTTGTTGGG + Intronic
995350959 5:111174998-111175020 GCTACCATGTGGCAGTGGGGTGG - Intergenic
995684350 5:114756112-114756134 CCTACTATCTGCCAGGAAGCAGG - Intergenic
998416614 5:141950829-141950851 CCTACTATGTGTCAGTTGCTGGG + Intronic
999189646 5:149737537-149737559 TCTTCTGTGTGGCAGTACGCAGG + Intronic
999204831 5:149840480-149840502 CCTTCTATGTGACCGTGGGCAGG + Intronic
1001366172 5:171142722-171142744 CCTACCATGTACCAGTATGCTGG + Intronic
1002029045 5:176414879-176414901 CCTACTGTGTGTCAGGACGCTGG - Intronic
1006421201 6:33935268-33935290 CCTGCGATGTGACAGTAGGTAGG + Intergenic
1006612564 6:35303162-35303184 CCTACTATCTGACAGCACGCGGG + Intronic
1007336089 6:41156220-41156242 CCTACTATGTGCCAGTCACCTGG + Intergenic
1014006883 6:116429349-116429371 CCTACTATGTGGCAGGTGTGGGG - Intronic
1021350540 7:19588330-19588352 CCTAATATCTATCAGTAGGCAGG - Intergenic
1021914060 7:25414134-25414156 TCTGCTTGGTGGCAGTAGGCGGG - Intergenic
1025249903 7:57344619-57344641 CCTACTATGTGCCAGGAGTGGGG + Intergenic
1026180065 7:68031249-68031271 CCCATATTGTGGCAGTAGGCAGG + Intergenic
1026508593 7:71007956-71007978 CCTACCATGTTCCAGAAGGCGGG + Intergenic
1026823894 7:73569124-73569146 CCCACTAGGTGACAGTAGCCAGG + Exonic
1032742621 7:134753986-134754008 CCTTCTCTCTGGCAGGAGGCTGG + Intronic
1042105531 8:65322343-65322365 CCTATTATGTGCCAGGAGCCAGG - Intergenic
1044766684 8:95583295-95583317 CCTACTATGTGCCTGGAGTCTGG + Intergenic
1046844350 8:118899420-118899442 CTTACTATGTGGCAGGCAGCTGG + Intergenic
1047211146 8:122841458-122841480 CCTACTGTGAGGCAGGAGGTGGG - Intronic
1048109934 8:131456600-131456622 CCTTCTAATTGGCAGCAGGCAGG - Intergenic
1049061350 8:140278446-140278468 CCTGCTATGTGCCAGTTGCCTGG - Intronic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1056439242 9:86603968-86603990 CCTACTGTGAGGCAATAGGGAGG - Intergenic
1056759976 9:89407553-89407575 GCTACTTTGTGGCAGTGGACTGG - Intronic
1057749877 9:97783796-97783818 GATACTATGTGGCAGTGGGTTGG + Intergenic
1058528337 9:105882379-105882401 CCTCCAAGGTGGCAGTAGGTTGG - Intergenic
1062040876 9:134403752-134403774 CCTACTTTGTGCCAGGAGCCTGG - Intronic
1185595955 X:1307121-1307143 CGTCTTATGTTGCAGTAGGCTGG + Intronic
1188907096 X:35802168-35802190 CCTTGTGGGTGGCAGTAGGCAGG - Exonic
1189865933 X:45327076-45327098 ACTGCTAAGTGGCAGAAGGCTGG - Intergenic
1191035088 X:56016740-56016762 CATATTGTGTGGCACTAGGCAGG - Intergenic
1195927139 X:110037579-110037601 CCGCCTATGTGACAGGAGGCAGG + Intronic
1197271888 X:124433588-124433610 CCTAGTATCTGGCATTAAGCTGG + Intronic
1198385858 X:136128891-136128913 CCCAGTATGTGGTAGGAGGCTGG + Intergenic