ID: 1089443726

View in Genome Browser
Species Human (GRCh38)
Location 11:118535188-118535210
Sequence TAGAATTCCCAAGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089443726_1089443733 13 Left 1089443726 11:118535188-118535210 CCCACCTCCTCTTGGGAATTCTA 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1089443733 11:118535224-118535246 ACCTTCTCTACTACTTCACTGGG 0: 1
1: 0
2: 1
3: 13
4: 177
1089443726_1089443732 12 Left 1089443726 11:118535188-118535210 CCCACCTCCTCTTGGGAATTCTA 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1089443732 11:118535223-118535245 GACCTTCTCTACTACTTCACTGG 0: 1
1: 1
2: 0
3: 9
4: 105
1089443726_1089443731 -10 Left 1089443726 11:118535188-118535210 CCCACCTCCTCTTGGGAATTCTA 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1089443731 11:118535201-118535223 GGGAATTCTAGGTTACACGTTGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089443726 Original CRISPR TAGAATTCCCAAGAGGAGGT GGG (reversed) Exonic
901586765 1:10301781-10301803 TAGAATTCCAAATAGTAAGTGGG - Intronic
904163532 1:28538166-28538188 GAAAATTCCAAAGAGGAGGAAGG - Intronic
905784655 1:40744686-40744708 TAGAACTCCCAAAAGTAGGGGGG + Intronic
906299667 1:44672878-44672900 TCGCAATCCCACGAGGAGGTAGG + Intronic
907602907 1:55788206-55788228 TAGAGTTCCCAAGATGTGGGGGG + Intergenic
908422228 1:63970170-63970192 TCGAATTCCCAAGTCTAGGTTGG + Intronic
908504346 1:64780943-64780965 TAGTATTATCAAGAGAAGGTAGG - Intronic
909372327 1:74898235-74898257 TAGAAATCACAACAGGAGATAGG + Intergenic
913661362 1:121008800-121008822 CAGTATTCCCAAGAGGGGTTCGG - Intergenic
914012729 1:143791980-143792002 CAGTATTCCCAAGAGGGGTTTGG - Intergenic
914165101 1:145169204-145169226 CAGTATTCCCAAGAGGGGTTTGG + Intergenic
914376780 1:147079440-147079462 CAGTATTCCCAAGAGGGGTTCGG + Intergenic
914651354 1:149700589-149700611 CAGTATTCCCAAGAGGGGTTTGG - Intergenic
916692120 1:167200522-167200544 TAACAACCCCAAGAGGAGGTTGG - Intergenic
916764310 1:167845515-167845537 TAGATTTCCCAAGAACAGTTAGG + Intronic
919545117 1:198906526-198906548 TAGAATTCCCAATACCTGGTAGG + Intergenic
920730147 1:208475721-208475743 TAGGATTGCCAAGAGGAGAGGGG + Intergenic
923306111 1:232690399-232690421 TAGAAAAACAAAGAGGAGGTAGG + Intergenic
924048776 1:240059714-240059736 CATCATTCCCAAGAGGAGTTTGG - Intronic
1064065487 10:12177556-12177578 CAGCATTGCCAAGAGGAGGTTGG + Intronic
1064582734 10:16810555-16810577 CAGAATTCCCAGGAGAAGTTGGG - Intronic
1064928872 10:20601506-20601528 AATAATTCCCACGAGGAGGAAGG - Intergenic
1065962285 10:30743498-30743520 GAGAAATACCAAGAGGAGTTTGG + Intergenic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1067253277 10:44608220-44608242 AAGAATCCCCAAGAGTAGATGGG + Intergenic
1067320772 10:45218699-45218721 CAGAATTCCCAGGAGAAGTTGGG - Intergenic
1067840161 10:49669315-49669337 GAGAAATCCCAGAAGGAGGTGGG - Intergenic
1068929519 10:62574884-62574906 GAGACCTCCCAAGAGGAGGTGGG - Intronic
1069761205 10:70812776-70812798 CAGAATGCCCAAGAAGAGGCAGG - Intergenic
1069763695 10:70835439-70835461 TAGAAATGCCAAGAAGAGGCCGG + Intronic
1069958257 10:72064505-72064527 CAGGATTCAGAAGAGGAGGTGGG + Intronic
1073105173 10:101028777-101028799 CAGAAGTCCCCAGAGGAGTTAGG - Intronic
1074885970 10:117693910-117693932 CAGAATTCCCAGGATGAGGTGGG - Intergenic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1077628698 11:3796618-3796640 AAGAATTCCCTTTAGGAGGTCGG - Intronic
1079301519 11:19283247-19283269 CCTAATTCCCAATAGGAGGTGGG - Intergenic
1087240717 11:95774362-95774384 TTCAATTACCAAGAGGAGGTAGG + Intronic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1088213678 11:107483921-107483943 TAGAAACTCAAAGAGGAGGTTGG - Intergenic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1089536218 11:119162082-119162104 TGGGATCCCCAGGAGGAGGTTGG - Exonic
1094493779 12:30977064-30977086 TAAAATTGCAATGAGGAGGTGGG + Intronic
1094879907 12:34710430-34710452 TAGAATTTCCAAGTGGATATTGG - Intergenic
1094880011 12:34712127-34712149 TAGAATTTCCAAGTGGATATTGG - Intergenic
1095030447 12:37268245-37268267 TAGAATTTCCAAGTGGATATTGG - Intergenic
1095030726 12:37273147-37273169 TAGAATTTCCAAGTGGATATTGG + Intergenic
1099917696 12:88915566-88915588 CAGAATTCCCAAGTGAAGGATGG + Intergenic
1103439878 12:120955186-120955208 TAGAATTCCCTAGAGGGCTTGGG + Intergenic
1105812830 13:24009811-24009833 TTGAATTCCAAAAAGGAGGAGGG + Intronic
1105840458 13:24249539-24249561 GAGAACCCCCAAGAGGAGATGGG + Exonic
1109199091 13:59410996-59411018 TTGAAAACCCAAGAGGTGGTTGG + Intergenic
1109680651 13:65748111-65748133 TAGAGGTCCCAAGATGTGGTGGG + Intergenic
1110786581 13:79535311-79535333 TAGAATTCTAAAGACAAGGTAGG + Intronic
1114420752 14:22580746-22580768 TACAATGCCCAAGAGGTGGTAGG + Intronic
1115203870 14:30880536-30880558 TAGCAGTCTCAAGAGGAGGGAGG - Intronic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1116535766 14:46027405-46027427 TAGAATTACCAAGATGCTGTAGG + Intergenic
1117031279 14:51673355-51673377 CAGAATCCCAAAGAGGAAGTAGG - Intronic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1118609475 14:67528952-67528974 AAGGATTCCAATGAGGAGGTGGG - Intronic
1120279480 14:82420937-82420959 AAGAGTTCCCAAGAGAAGGTAGG + Intergenic
1121606784 14:95246445-95246467 CACAGTTCCCAAGAGGAGGGGGG - Intronic
1123126990 14:105953882-105953904 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123407452 15:20029702-20029724 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1123516779 15:21036358-21036380 TAAAATCTCCTAGAGGAGGTTGG - Intergenic
1125687331 15:41571205-41571227 TAGATTTTCCAAGAAGAGCTGGG + Intronic
1126837119 15:52678952-52678974 GAGAAGTGCCAAGAGGAGGCGGG - Intronic
1130747779 15:86674549-86674571 AAGAATTCCCAAGTAAAGGTAGG + Intronic
1130773240 15:86946549-86946571 AAGAAATACCATGAGGAGGTTGG + Intronic
1131847874 15:96507181-96507203 TGGAATTTCCAACAGGAGGCAGG + Intergenic
1133863281 16:9616991-9617013 TAGAGCTCCCAAGAGTGGGTGGG + Intergenic
1133863958 16:9624404-9624426 TATAATTCCCAAAATGAGATTGG - Intergenic
1136506112 16:30704368-30704390 TAAAATACTCAAGAGGACGTGGG - Intronic
1136676065 16:31907296-31907318 TAGAATTCTCATGAGTATGTTGG + Intronic
1137555323 16:49466856-49466878 TAGAAGTTGCAAGAGGAGGAAGG + Intergenic
1137927458 16:52554113-52554135 CAGCATTCCCAAGAAGGGGTAGG - Intergenic
1139208937 16:65057288-65057310 GAGAAGTCCCGAGAGTAGGTAGG - Intronic
1139775471 16:69314291-69314313 TAGAATTTCCAAAAGGAGGGAGG + Intronic
1140407956 16:74723534-74723556 AAGGAAACCCAAGAGGAGGTGGG - Intronic
1143891437 17:10105513-10105535 TAGCATTCCCAGGATGAGGCAGG + Intronic
1148989716 17:51654911-51654933 TAGAATTAGAAAGAGGTGGTGGG - Intronic
1151117252 17:71751390-71751412 TATGATTCCCAAGTGGTGGTGGG - Intergenic
1151840172 17:76611991-76612013 TAGAGCTCCCAAGATGGGGTGGG + Intergenic
1153596158 18:6727401-6727423 GTGAATTCACAAGAGGAGGAGGG + Intergenic
1163796599 19:19341615-19341637 TAGTACTCCCAAAGGGAGGTGGG - Intronic
1164707132 19:30328179-30328201 CAGAACTCCCCAGGGGAGGTGGG + Intronic
927806172 2:26148763-26148785 TAGATTTCCCAGTAGGAAGTAGG - Intergenic
929581888 2:43086563-43086585 TGGACTCCCCAAGAGGAAGTGGG - Intergenic
929891194 2:45919688-45919710 TAGATTTTCCAAGAAAAGGTTGG - Intronic
932096149 2:68850585-68850607 TAGCATTCCTAAGTGAAGGTGGG - Intergenic
934960147 2:98665886-98665908 AAGAAATACCAAGAGCAGGTTGG + Intronic
937556675 2:123166416-123166438 TAGAATACCAAAGAGATGGTAGG + Intergenic
938967605 2:136402246-136402268 CAGGAATCCCAGGAGGAGGTTGG - Intergenic
939011031 2:136846053-136846075 TAGACTTCCCAAGACGAGCAAGG + Intronic
940712610 2:157180516-157180538 TAGAATTCTCAAGATGAAGCTGG - Intergenic
940822850 2:158376748-158376770 TAGAATTGAAAAGAGGAGATAGG - Intronic
943656587 2:190515168-190515190 TAGAATACCTAAGAGGTGATGGG - Intronic
947879330 2:233491680-233491702 CAGAATTTTCAAGAGGAGGCAGG + Intronic
1168945450 20:1751643-1751665 TAGAATTCCCTTAAGGAGCTTGG - Intergenic
1169450414 20:5706112-5706134 TAGAGTTCCCCAGTGGAGGCTGG + Intergenic
1173384872 20:42577989-42578011 GTGAATTCCCATTAGGAGGTGGG + Intronic
1173428643 20:42966074-42966096 TGGAATAGCCAAGAGGAGTTGGG + Intronic
1173547348 20:43908997-43909019 CAGAATTCCCCAGTGGAGTTAGG + Intergenic
1173894222 20:46538103-46538125 TGCAATTGCCAAGAGGATGTGGG - Intergenic
1174502915 20:50998921-50998943 CACAGTTCCCAAGAGGAGGGTGG + Intergenic
1175011812 20:55745206-55745228 GAGAATTACCAACAGGAGGTGGG + Intergenic
1175793765 20:61758482-61758504 CAGAATTGCCACGAGGAGTTAGG + Intronic
1176273065 20:64246557-64246579 GATAATTCCCCAGAGCAGGTGGG + Intergenic
1177023190 21:15888527-15888549 CAGAATTACCATGAGCAGGTAGG - Intergenic
1177144717 21:17394979-17395001 TACCATTCCCAAGATGAGGACGG + Intergenic
1177491182 21:21828347-21828369 CTGAATTCCAAAAAGGAGGTGGG + Intergenic
949461914 3:4303270-4303292 TACAATTCCCATGAGGCGGTGGG + Intronic
949622040 3:5824270-5824292 TAAAATACCCACGAGGTGGTTGG - Intergenic
951263608 3:20540955-20540977 TAGAATTCAGAAGAGGAAATAGG + Intergenic
955219079 3:57009020-57009042 TAGCATTCTCAACAGGAGGCAGG + Intronic
960197431 3:114786540-114786562 CAGAATTTCCAAGAGGAGTGGGG + Intronic
961150906 3:124637011-124637033 TAGAATTCCTAATAAGGGGTTGG + Intronic
961478084 3:127161057-127161079 TAGGATGCCCAAGAGGGGTTAGG - Intergenic
964765343 3:160173693-160173715 TACACTTCCCCAGAGGAGGAGGG - Intergenic
965330242 3:167363663-167363685 TAGAATTGTCAAGATGATGTGGG - Intronic
968773658 4:2525481-2525503 TAGAATTCACCAGTGAAGGTCGG - Intronic
973218411 4:47697762-47697784 GAGAATTCCCATGAGGAGAAAGG + Intronic
976817123 4:89161769-89161791 GAGACCTCCCAAGATGAGGTGGG + Intergenic
977775221 4:100910929-100910951 TTGAATTGTCAAGTGGAGGTAGG + Intergenic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
979306269 4:119147876-119147898 TAGAAAGCCCAAGAGGAGAAGGG + Intronic
979327275 4:119394802-119394824 AAGAGTTCCCAAGAGAAGGATGG - Intergenic
979499465 4:121422596-121422618 TAGAAATCACGAGAGGAGGCCGG - Intergenic
979507988 4:121519842-121519864 TAGAAACACCAAGAGTAGGTTGG - Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
981961590 4:150546909-150546931 TAAATTTCCCAACAGAAGGTTGG - Intronic
983245159 4:165279490-165279512 AAGAGTTCCCAAGAGAAGGATGG - Intronic
984182199 4:176497662-176497684 TTGAAATCCCAAAAGGAGGCTGG - Intergenic
984437904 4:179727442-179727464 TTGAATTCCAAAAAGAAGGTAGG + Intergenic
988099627 5:26660057-26660079 TAGAGCTCCCAAGAGGATGGCGG + Intergenic
994633458 5:102314551-102314573 GGGAACTTCCAAGAGGAGGTGGG + Intergenic
999690987 5:154145693-154145715 TATTATTCCCATGAGAAGGTAGG + Intronic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1004148090 6:13088999-13089021 TAGATTTGCCAAGAGGTGATAGG + Intronic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1004966548 6:20858153-20858175 TAAAATTCCCCAGAAGAGGACGG - Intronic
1005300251 6:24463463-24463485 AGGAATTCCAAAAAGGAGGTGGG + Intronic
1010993452 6:82505920-82505942 CAGAATTCCCAAGAAGATGTGGG - Intergenic
1015450950 6:133365486-133365508 TACATTTCCCAAGAGGAGGGGGG + Intronic
1018866487 6:167750586-167750608 TTGAATTCCAAAAGGGAGGTGGG - Intergenic
1021126272 7:16853684-16853706 TAGAGCTCCCAAGATGGGGTGGG - Intergenic
1022133326 7:27424239-27424261 GAGAACTTCCCAGAGGAGGTGGG + Intergenic
1025876727 7:65487621-65487643 TAGAATGTACAACAGGAGGTTGG - Intergenic
1026033054 7:66811928-66811950 TAGAAAACCCAAGAGAAGGCTGG + Intergenic
1027697386 7:81428967-81428989 AAGAATTACCTAGAGGAGATAGG - Intergenic
1028671010 7:93399998-93400020 TACAATTCCCAAAAGAAGGCAGG - Intergenic
1029992385 7:104974114-104974136 CTGAAATCCCAAGAGGAGGTTGG - Intergenic
1031919778 7:127592120-127592142 TAAAATTACCCAGAGGAGGCCGG + Intronic
1032531018 7:132620218-132620240 CAGAAATCACAAGAGTAGGTGGG - Intronic
1032713584 7:134484659-134484681 AAGAATTCCCTAAAGGAGTTTGG - Intergenic
1032806078 7:135355655-135355677 TGGAATTACCAAGATGAGGGTGG - Intergenic
1032878771 7:136066238-136066260 TAGAAATCCCAAGATGAAATAGG - Intergenic
1033293660 7:140111571-140111593 TAGATTTCCCAAGAGAAATTAGG - Intronic
1034882070 7:154770405-154770427 TTGAATTCCCAAGATGAGGGAGG - Intronic
1035896530 8:3408972-3408994 TAGTATTCTTAAGAGGAAGTGGG + Intronic
1035998548 8:4576214-4576236 TGGAATTCAGAAGACGAGGTGGG - Intronic
1038044419 8:23754001-23754023 CAAAATTCCCAAGAGAAGGAGGG - Intergenic
1039255364 8:35712684-35712706 CAGAATTCCTCAGAGGATGTGGG + Intronic
1040120634 8:43681200-43681222 TAGAATCTGCAAAAGGAGGTTGG + Intergenic
1040561048 8:48523819-48523841 CAGCATCCCCCAGAGGAGGTGGG - Intergenic
1041518954 8:58733560-58733582 TGGAATCCCCATGAGGAGATTGG + Intergenic
1041839898 8:62256704-62256726 TAGAAGCCCCAGGAGGAAGTGGG + Intronic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1044002651 8:86903194-86903216 AAGAATTTCCAAGATGTGGTGGG - Intronic
1045144140 8:99320333-99320355 TAGGATTCCCAGGAGAAGGGAGG - Intronic
1046730188 8:117717022-117717044 TAGAAATACCAAGAGCAGGATGG + Intergenic
1047509896 8:125508005-125508027 AAGAAATGCCAAGAGGTGGTAGG - Intergenic
1047936682 8:129787450-129787472 TGGAATACCCAATAGCAGGTTGG - Intergenic
1053589609 9:39498614-39498636 TAGAATTGCCAAGTAGAGGATGG - Intergenic
1054576688 9:66866672-66866694 TAGAATTGCCAAGTAGAGGATGG + Intronic
1054874262 9:70078902-70078924 TAGAATTCCTAAGGGAAGGAGGG - Intronic
1056071442 9:82991253-82991275 TAAAAATCCCAAAAGTAGGTAGG - Intronic
1056312823 9:85358581-85358603 TAGAGTTCACAAGGGGAGTTGGG + Intergenic
1059554607 9:115266836-115266858 GAGGGTTCTCAAGAGGAGGTAGG - Intronic
1061583533 9:131552485-131552507 TACAATTCCCTGGAGAAGGTGGG + Intergenic
1061782335 9:133003525-133003547 AAGAAATCCCCAGAGGAGCTGGG - Intergenic
1203356990 Un_KI270442v1:162027-162049 TAGAATTTCCAAGTGGACATTGG - Intergenic
1187191393 X:17038612-17038634 TAGAATTCCAAATAGGACTTAGG - Intronic
1188285641 X:28322827-28322849 TAGAGCTCCCAAGATGCGGTGGG - Intergenic
1188314867 X:28660871-28660893 TAGTTTTGGCAAGAGGAGGTTGG + Intronic
1189756937 X:44282025-44282047 TGGAGTTCCTGAGAGGAGGTAGG - Intronic
1193968436 X:88019687-88019709 TAGCATTCCCAGGCAGAGGTAGG - Intergenic
1194924072 X:99803694-99803716 GAGAACTGCCTAGAGGAGGTAGG - Intergenic
1196386959 X:115166352-115166374 TAGAAATCCTAAGAGCAGTTAGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197492750 X:127138955-127138977 TTGAGTTCCCAGGAGGGGGTTGG - Intergenic
1198089893 X:133318167-133318189 TAGAATTGCAAAGAGGAAGATGG - Intronic
1199199991 X:145075894-145075916 TCGAATTGCCAAAATGAGGTGGG - Intergenic
1201512442 Y:14780141-14780163 TATAATTGGCAAGAGGAGTTTGG - Intronic