ID: 1089453475

View in Genome Browser
Species Human (GRCh38)
Location 11:118612390-118612412
Sequence CAGCATTTTCTGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089453475_1089453482 -1 Left 1089453475 11:118612390-118612412 CCCTCCTCCCTCAGAAAATGCTG 0: 1
1: 0
2: 3
3: 29
4: 374
Right 1089453482 11:118612412-118612434 GAGGGATTTCCCTGAGTCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1089453475_1089453485 26 Left 1089453475 11:118612390-118612412 CCCTCCTCCCTCAGAAAATGCTG 0: 1
1: 0
2: 3
3: 29
4: 374
Right 1089453485 11:118612439-118612461 AGTACAGCAATCTTTGTCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089453475 Original CRISPR CAGCATTTTCTGAGGGAGGA GGG (reversed) Intronic
900546669 1:3233269-3233291 CAGCATTTTCAGAAGCAGGGTGG + Intronic
900763466 1:4488258-4488280 CAGCAGTTTCCTTGGGAGGAAGG + Intergenic
902634825 1:17728447-17728469 CAGCATTTTGGGAGGGATGCAGG - Intergenic
902938103 1:19779327-19779349 CAGACTTTTCTCAGGGAGAATGG - Intronic
903132080 1:21286206-21286228 CACCATTTTCAGCGGCAGGAAGG - Intronic
903465196 1:23547151-23547173 GAGATTTTTCTGAGGGAGGCAGG + Intergenic
905480030 1:38255400-38255422 CGCAATTTTCTGTGGGAGGAGGG + Intergenic
906366390 1:45213636-45213658 CAGCATTTTATGAGGCTGGCTGG + Intronic
907316701 1:53577052-53577074 CAGCATTTATTGGGGGAGGGAGG - Intronic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
908313974 1:62914695-62914717 CAGCAAGTCCTGAGGCAGGATGG + Intergenic
908708136 1:66983152-66983174 CAGCTTTTTCAAAGGAAGGAAGG + Intronic
910556283 1:88537424-88537446 AATAATTTTCTGAGGGAAGAGGG + Intergenic
910685000 1:89907069-89907091 CAGCATTTACTCATGCAGGAAGG + Intronic
911349072 1:96729973-96729995 CAGCACTTTGTGAGGCAGGGCGG - Intronic
911785813 1:101945480-101945502 CAGTGGTTTCTGTGGGAGGAGGG + Intronic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
912954846 1:114148113-114148135 CAGCATTTTCTGGAAGAGGAGGG - Intronic
914862442 1:151397897-151397919 CACCAGTCTCTGTGGGAGGATGG + Intergenic
915903720 1:159863369-159863391 CAGCAATGTCTGTGGGAGGGAGG + Intronic
916358745 1:163943447-163943469 CAGCACTTTGGGAGGGAGGCAGG + Intergenic
917268500 1:173247357-173247379 GAGTATGTTCTGAAGGAGGAGGG + Intergenic
917339605 1:173961717-173961739 CAGCATACTCTGAGGTACGAAGG + Exonic
917664167 1:177207761-177207783 CAGCCTTTTTTGAGGGAGCAGGG - Intronic
917767718 1:178241644-178241666 CATCCATTTCTGAGAGAGGAAGG - Intronic
918725008 1:187909864-187909886 TAGCATTTTAAGAGGCAGGATGG - Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
919761643 1:201101928-201101950 CAACATATGCTGATGGAGGAGGG - Intronic
921149518 1:212388371-212388393 CAGGATTTTGTGAGGGAGGTAGG - Intronic
921167663 1:212518565-212518587 AACCATTAGCTGAGGGAGGAGGG + Intergenic
922097189 1:222452504-222452526 CAGCATTTTCTGATTGGGGTGGG - Intergenic
922529623 1:226334503-226334525 CAGCATTTTGGGAGGCAGTAGGG - Intergenic
923586611 1:235278488-235278510 CACCATTTTCTTAGGGAAAATGG - Intronic
924149932 1:241119343-241119365 AAGCATTTTCTGTGCAAGGATGG - Intronic
924270378 1:242326121-242326143 CAGCACTTTGGGAGGGAGGGGGG - Intronic
924567994 1:245213808-245213830 CAGAATTTCCTGATTGAGGATGG + Intronic
1063185447 10:3646426-3646448 CAGCATATTCTGGGGCAGGTGGG + Intergenic
1063496299 10:6512260-6512282 CAGCTTTTGCTGAGGGTGCATGG - Intronic
1063931289 10:11030824-11030846 GAGCAATTTCTGAGGCTGGAAGG + Intronic
1064235363 10:13568889-13568911 GAGCATTTTTTGGAGGAGGAGGG - Intergenic
1064262824 10:13799572-13799594 GGGCATTTTCAGAGGCAGGAAGG - Intronic
1064823908 10:19373257-19373279 CAGCACTTTGGGAGGGCGGACGG + Intronic
1065632878 10:27698575-27698597 CGGCATTGTCTGAGGAAGGGGGG + Intronic
1066261848 10:33736990-33737012 CAGCAATTTCTGATGCAGGCAGG - Intergenic
1066363066 10:34749772-34749794 CAGCACTTTGAGAGGCAGGAGGG + Intronic
1066714553 10:38272681-38272703 CAGCACTTTGGGAGGGAGGGGGG + Intergenic
1066783519 10:38978029-38978051 CAGCACTTTGGGAGGGAGGGGGG - Intergenic
1067214566 10:44291897-44291919 CAGCGTTTTTTCAGAGAGGAGGG - Intergenic
1067745366 10:48931674-48931696 CAGCATTTTCTGAAAGACAAGGG - Intronic
1068566855 10:58585620-58585642 AAGGTTTTTCTGGGGGAGGAGGG - Intronic
1069529337 10:69204470-69204492 CAGCACTTTGGGAGGCAGGAAGG + Intronic
1071774982 10:88776828-88776850 CATCATTTTCTGATAGAGAAAGG - Intronic
1072610397 10:97013981-97014003 CAGCAGTGTCTGGGGGAGGTGGG - Intronic
1073178186 10:101569208-101569230 CAGCATTGATTGAGGGGGGAGGG - Intergenic
1073676047 10:105648182-105648204 CTGCATTTTTTGAGGAAGAAAGG - Intergenic
1074470836 10:113725278-113725300 CAGCATTTTCAGAGGCAGCCTGG - Intronic
1074535754 10:114327858-114327880 CAGCATACTCTGGGGCAGGATGG - Intronic
1075614639 10:123882607-123882629 CACCATTTTCTGGGGAAGGCTGG - Intronic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1080305663 11:30832039-30832061 GAGAATGTTCTGAGTGAGGAGGG + Intronic
1081076027 11:38675008-38675030 CAGCTCTTTCTGAGGGCTGAAGG + Intergenic
1081795656 11:45817541-45817563 AATCATTTTATGTGGGAGGATGG - Intergenic
1081830093 11:46102667-46102689 CAGCAATTTCTGAGGTAAAAAGG + Intronic
1081868050 11:46370443-46370465 CTGCACTTACTGAGGGAGGCGGG - Intronic
1083329903 11:61892497-61892519 CAGCATTTTGGGAGGCGGGAGGG - Intergenic
1084430596 11:69108641-69108663 TAGCACTTTCAGAGGGAGGGCGG + Intergenic
1084516713 11:69641667-69641689 GGGTATTTTCTGAAGGAGGAAGG + Intronic
1085737609 11:79052814-79052836 CAGAATAGTCTGTGGGAGGAAGG - Intronic
1087686028 11:101266162-101266184 CATAATTTTTTGAGAGAGGAAGG + Intergenic
1087934074 11:104011959-104011981 TTGCATTTTCTGAGAGAGGCAGG - Intronic
1089444422 11:118540470-118540492 CAGGACCTTCTGAGGGAGCATGG - Intronic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1089683436 11:120132281-120132303 AACCACTTTCTGAGGGAAGAGGG - Intronic
1089685014 11:120141211-120141233 CAGCATGTGCTGAGAGAGGCTGG + Intronic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1091693819 12:2614693-2614715 CAGCATTTGCTGTGAAAGGATGG + Intronic
1092582382 12:9857154-9857176 GAGAATTGTCTGAGGAAGGAGGG - Intronic
1092865063 12:12753071-12753093 TAGCCTATTGTGAGGGAGGATGG - Intronic
1095474865 12:42576003-42576025 CAGTGTTTTGTAAGGGAGGAAGG - Intronic
1096055926 12:48651861-48651883 CAGCACTTTCTGGGGAATGAGGG - Intergenic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1096916570 12:55039790-55039812 CAGGATTTGGTGAGGGGGGAAGG - Intergenic
1096978061 12:55711229-55711251 CAGCACTTTGGGAGGGAGGGAGG + Intronic
1097115967 12:56697573-56697595 CAGCATTTTAGGAGCGAGGTGGG - Intergenic
1100193769 12:92220670-92220692 CAGCATGTTCTTAGGAAGGGTGG + Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1101984327 12:109433791-109433813 CAGCACATCCTGAGGGAGGCAGG + Intronic
1102729084 12:115092160-115092182 CAGCACTTTGGGAGGCAGGAAGG - Intergenic
1103163943 12:118754075-118754097 CAGCATGTCCTGAGTGAGCAGGG + Intergenic
1104705143 12:130939143-130939165 CAGCACTTTGGGAGGCAGGAGGG - Intergenic
1104753336 12:131253699-131253721 CCCCATTTGATGAGGGAGGATGG + Intergenic
1104908271 12:132227058-132227080 TAGCTTTTTCTTTGGGAGGAGGG + Intronic
1105284234 13:18991720-18991742 CAGCATTTTCTAGTGGATGAAGG - Intergenic
1105715878 13:23064416-23064438 CAGCATTTCCTTAGGATGGAAGG + Intergenic
1106728351 13:32510744-32510766 CAGCATTTTCGGAGGCCGGGTGG - Intronic
1108505359 13:51108019-51108041 CAGCACCTTCAGAGGGAGCATGG - Intergenic
1109827860 13:67746313-67746335 CAACATTTTCTGAAGGAAGAAGG + Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1112582349 13:100687471-100687493 CAGAATTTTCTGGGGGAAGTGGG + Intergenic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113717027 13:112517642-112517664 CAGCACTTTGGGAGGGAGGCAGG + Intronic
1114271524 14:21103246-21103268 GAGCATTCTCTCAGGGTGGAAGG - Exonic
1114664795 14:24371154-24371176 CAAGATTCTCTGAGGGTGGAAGG - Intronic
1114676472 14:24443490-24443512 AAACATTTTCAAAGGGAGGAAGG - Intergenic
1115230134 14:31151636-31151658 CAGCACTTTGAGATGGAGGAGGG - Intronic
1115964825 14:38876330-38876352 TAGTATTTTCTGATGGAGGGTGG - Intergenic
1116454464 14:45102683-45102705 CATCATTTTCAGAGGTAGGTGGG + Exonic
1117584417 14:57185616-57185638 CAGCCTTGTCTGGGGGAGAATGG - Intergenic
1117967811 14:61223543-61223565 CAGAATCTTCCCAGGGAGGAGGG - Intronic
1118050416 14:62020527-62020549 CCACATTTTCCAAGGGAGGAGGG + Intronic
1118126590 14:62911786-62911808 CAGCACTTTAGGAGGGAGGCAGG + Intronic
1118147419 14:63155716-63155738 CATCACTTTCTGTGTGAGGAGGG + Intergenic
1118163200 14:63311323-63311345 CAGAATTTTCTGAGGCACAAAGG - Intergenic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1119321237 14:73732112-73732134 CAGCTTGTTCTGAGACAGGAAGG - Intronic
1120457446 14:84750468-84750490 CAGCAGTCTCTGGTGGAGGAAGG + Intergenic
1120495045 14:85224323-85224345 CAGCAATTTCTGACAGATGATGG - Intergenic
1120646077 14:87075870-87075892 CAACTTTTGCTGGGGGAGGATGG + Intergenic
1121003738 14:90472819-90472841 AAGCATTGTCTGCGGCAGGATGG - Intergenic
1121253445 14:92515326-92515348 GAGGAGTTTCTCAGGGAGGAAGG + Intronic
1122143612 14:99676262-99676284 CAGCACCTGCTCAGGGAGGATGG + Exonic
1123003993 14:105312664-105312686 CATCATTTTCCGACAGAGGAGGG + Exonic
1124597014 15:31099736-31099758 TTACATTTTCTGGGGGAGGAGGG + Intronic
1124994440 15:34709224-34709246 CAGCCTCTTCTAAGGCAGGAGGG - Intergenic
1125838849 15:42779155-42779177 CAGCACTTTGGGAGGGAGGTGGG + Intronic
1126747182 15:51837863-51837885 CAGTTTCTTCTGAGGTAGGAGGG - Intronic
1127431961 15:58919344-58919366 CAGCATTTTGGGAGGCTGGAGGG + Intronic
1127712418 15:61613024-61613046 CAGCCATTTCTGTGGCAGGATGG + Intergenic
1128392420 15:67191128-67191150 CAGTATGTTCTGAGAGGGGAGGG - Exonic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1130891248 15:88135690-88135712 CACCATCTTCTGAGGGACAAAGG + Intronic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132846286 16:2002367-2002389 AAGCACTTTCTGTGTGAGGAAGG - Exonic
1134092088 16:11396896-11396918 CAGCACTTACGGAGGGAGCAAGG - Intronic
1134295380 16:12940803-12940825 CACCATTTTTTAAGAGAGGAAGG - Intronic
1135009777 16:18864814-18864836 CACCATTTTTTGTGGGAGGGGGG - Intronic
1136313481 16:29432447-29432469 CACCATTTTTTGTGGGAGGGGGG - Intergenic
1136326923 16:29534213-29534235 CACCATTTTTTGTGGGAGGGGGG - Intergenic
1136441614 16:30274197-30274219 CACCATTTTTTGTGGGAGGGGGG - Intergenic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1138347370 16:56328356-56328378 CAGAGTTTTCTGGGGCAGGAAGG - Intronic
1143314972 17:6025683-6025705 TAGCATGATCTGAGGGTGGAGGG + Intronic
1143651078 17:8264660-8264682 CAGCACTTTCTAAGGGTGGGAGG - Intronic
1143819461 17:9548033-9548055 CAGCACTTTGGGAGGCAGGAGGG - Intronic
1144328055 17:14200531-14200553 CTCCATTTTCTGAGGAAGGAGGG + Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1144806821 17:17973202-17973224 AAGCATTTCCCGAGGGAGCAGGG + Intronic
1145854970 17:28146359-28146381 CATCGTTATATGAGGGAGGAGGG - Intronic
1146087923 17:29847475-29847497 CAGGTTTTTTTGAGGGAGGGTGG + Intronic
1146296264 17:31653100-31653122 AAGCTTTTTCTCATGGAGGAAGG + Intergenic
1146679611 17:34797652-34797674 CATCATCTTCTGAGGGAGCAAGG - Intergenic
1147692760 17:42327206-42327228 CAGTTATTTCTGAGGGAGGAGGG - Intronic
1147995971 17:44360718-44360740 CAGCAGTTTGAAAGGGAGGATGG + Intronic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1148249091 17:46059193-46059215 CAGCTTTTTCTTTGGGAGGGTGG - Intronic
1148283721 17:46369676-46369698 CATCATTTTTTAAGGAAGGAAGG - Intergenic
1148305939 17:46587593-46587615 CATCATTTTTTAAGGAAGGAAGG - Intergenic
1148850099 17:50550448-50550470 CAACATTCTCTGAGGCAGGCGGG - Intronic
1149690136 17:58568505-58568527 ATGCATTTTCTGAGGGTGAAGGG + Intronic
1149914681 17:60598319-60598341 CTTGAGTTTCTGAGGGAGGAAGG + Intergenic
1150746770 17:67823137-67823159 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1150905128 17:69328283-69328305 CAGTTTTTTCTGGGGGAGGGAGG + Intergenic
1151084767 17:71367299-71367321 CAGAATCTTCTGATGGAAGATGG - Intergenic
1151440873 17:74128296-74128318 CAGCATTTTATGAGGTGGGTGGG + Intergenic
1152394896 17:80026438-80026460 CATCATCTTCTGGGGGAGGGGGG + Intronic
1152496240 17:80674401-80674423 CAGCACTTTCACAGGGAGGCTGG + Intronic
1153778702 18:8476065-8476087 GAGCATGTTCTCTGGGAGGAGGG + Intergenic
1154362650 18:13676738-13676760 CAGCATTCTATGGTGGAGGAGGG + Intronic
1155298434 18:24406890-24406912 GAGCATTCTCTGAAGGAGGGAGG - Intergenic
1155399368 18:25420926-25420948 CAGCCTTCTGTGAGGAAGGAAGG + Intergenic
1156526897 18:37776272-37776294 CAGCATTTGGTGGGAGAGGACGG + Intergenic
1156904259 18:42335557-42335579 CAGCACTTTCCCAGGGAAGATGG + Intergenic
1158799851 18:60893504-60893526 CAGCATTTTGTAAAGGAGGGTGG - Intergenic
1159286233 18:66357485-66357507 CAGCTTTGTCTGAGGGGCGATGG - Intergenic
1160221429 18:76980635-76980657 TAGCATTTGCTGAGGGAGGTCGG - Intronic
1160288711 18:77570787-77570809 CAGCGTTTTGAGAGGGAGGTGGG - Intergenic
1161528783 19:4774159-4774181 CAGGATTTTCTGTGTGATGAAGG - Intergenic
1162039493 19:7961441-7961463 CAGCATCTTCTGATGGAAGGTGG - Exonic
1162699316 19:12501884-12501906 CAGCATTTTGGGACTGAGGATGG - Intronic
1165188395 19:34041205-34041227 GAGCAGTTTCTGTGGAAGGATGG - Intergenic
1165545687 19:36533620-36533642 CAGCATTTCCTGTGGTGGGAGGG - Intergenic
1165604893 19:37093465-37093487 CAGCACTTTGGGAGGGAGGTGGG - Intronic
1165711938 19:38017776-38017798 CAGCATTTTGGGAGGCAAGATGG - Intronic
1165891860 19:39117455-39117477 CAGCACTTTGGGAGGCAGGAGGG - Intergenic
1167257851 19:48442043-48442065 CACCAGGGTCTGAGGGAGGAAGG + Intronic
1167327897 19:48836573-48836595 GAGGAGTGTCTGAGGGAGGAGGG - Exonic
1167378180 19:49123275-49123297 CAGCACTTTGGGAGGCAGGAGGG - Intronic
1167495939 19:49818743-49818765 CTCCTTGTTCTGAGGGAGGAGGG + Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926604463 2:14883667-14883689 CAGTCATTTCTGGGGGAGGAGGG - Intergenic
926787909 2:16536672-16536694 CAGCATGTGCTAAGGCAGGAAGG + Intergenic
928208721 2:29307170-29307192 CAGTATTTTCTGTGGGTTGAAGG - Intronic
928429166 2:31203680-31203702 CAGGATTTTCTGAGAGAAGTAGG + Intronic
928510231 2:31996144-31996166 TAGCACTTTCGGAGGGAGGAAGG + Intronic
929484712 2:42343020-42343042 CAGCACCTCCTGAGGTAGGAGGG - Intronic
929837720 2:45422376-45422398 CACCATTGTCTGTGGGAGGTGGG - Intronic
931115932 2:59166735-59166757 TAGCACTTTCAGAGGGAGTATGG + Intergenic
931617562 2:64175796-64175818 CAGCATTGTCTGAAGGAGAGGGG - Intergenic
934085857 2:88508973-88508995 CAGAATTTGATGAGGGAGGCTGG - Intergenic
936935856 2:117837451-117837473 CAGCATTTTCACAGGCGGGAAGG - Intergenic
937787288 2:125916866-125916888 CAGCAAATTCTGGGGGAGGGAGG - Intergenic
938175787 2:129127525-129127547 CAGCATTCCCTGAGGAAGGCAGG - Intergenic
938582255 2:132657246-132657268 TATAACTTTCTGAGGGAGGAAGG + Intronic
940046972 2:149420345-149420367 CAACATTTTCAGAGGCAGCATGG - Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940579105 2:155553522-155553544 TAGCATTTCCTGAGGAAAGAGGG + Intergenic
941290479 2:163667812-163667834 CAGAGTCTTGTGAGGGAGGAAGG - Intronic
941344605 2:164352161-164352183 TAGCATCTTCAGAGGGAGCATGG - Intergenic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942009797 2:171749724-171749746 TCGCATTTTCTGGGGGAGTAGGG - Intergenic
943713449 2:191123983-191124005 CAGCAGTTTCTAAGGATGGAAGG - Intronic
945480614 2:210340675-210340697 GACCATTTTTTGAGTGAGGAGGG + Intergenic
945923584 2:215780754-215780776 CAGCATTTTCTAATTGAAGAGGG - Intergenic
946406438 2:219494468-219494490 CAGCATTTTCCTAGGGCTGAGGG + Intronic
946459169 2:219853817-219853839 CTGCATTTTATGGGGGAGGGAGG - Intergenic
948355480 2:237374014-237374036 CAGCCTTCTGTGAGGCAGGAAGG - Intronic
948421301 2:237862026-237862048 CAGCATTCCCTGAGTGAAGATGG - Intronic
948789513 2:240370083-240370105 CAGCTGTGTCTGGGGGAGGAGGG + Intergenic
1170826102 20:19797260-19797282 CTGCATATTCTAAGAGAGGAAGG - Intergenic
1172365888 20:34348997-34349019 CAGCCTTTTCTTAGAGATGAGGG + Intergenic
1175264235 20:57692830-57692852 CAGCAATGTCTCAGGGAGCAGGG + Intronic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176236376 20:64055646-64055668 TTGCATTTTCTGAGTGAGGTGGG + Intronic
1176306148 21:5124101-5124123 CAGCACTTTGGGAGGCAGGAGGG + Intronic
1178267780 21:31160046-31160068 CAGCCCGTTCTGAGGGGGGATGG + Intronic
1179850910 21:44137930-44137952 CAGCACTTTGGGAGGCAGGAGGG - Intronic
1180199068 21:46213982-46214004 AGGCATTTCCTGAGCGAGGATGG + Intronic
1180242060 21:46515782-46515804 CAGCACTTTGGGAGGGAGGCCGG - Intronic
1181237645 22:21457382-21457404 CAGCATCTCCTGAGGAAGTAAGG + Intergenic
1181408738 22:22703343-22703365 CAGCATCTCCTGAAGGAGGCTGG - Intergenic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1182696606 22:32202977-32202999 CAGCATTTCCTGAGCGCGGCAGG - Exonic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
1183997759 22:41648330-41648352 CAGCATGTACTGAGTGATGAAGG - Intronic
1184412476 22:44332888-44332910 CCGCATTTTAGGAGGGAGAAGGG + Intergenic
949459675 3:4276949-4276971 CAGGATGTTCTGAGGGAAGATGG + Intronic
949577941 3:5357110-5357132 CAACCTTTTCTGTGGAAGGAAGG + Intergenic
949893739 3:8753502-8753524 CAGCTTCTGCTGAGGGAGGTAGG - Intronic
950665985 3:14495167-14495189 GAGCATCTGCTGAGGGAGGTTGG - Intronic
952867747 3:37865926-37865948 CAGCCTTTGCTGTGGGAGGCAGG + Intronic
953036686 3:39217681-39217703 TAGCATTTACTGAGGGATGAGGG - Intergenic
953435622 3:42875020-42875042 CTTCAGTTTCTGAGGGAGCAGGG - Exonic
953908137 3:46878615-46878637 AGGGGTTTTCTGAGGGAGGAAGG + Intronic
955972617 3:64450857-64450879 CAGCATATTTTGGGGGAGGTGGG + Intergenic
956456600 3:69427194-69427216 CAATATTTTCTGTGGGAGAAGGG + Intronic
956471271 3:69569621-69569643 CAGCATCTTTTGAGGAAGGGAGG + Intergenic
956821279 3:72956644-72956666 CAGCACTTTGGGAGGGAGGTGGG + Intronic
956848430 3:73205537-73205559 CAGCAATTTGGGAGGGTGGATGG + Intergenic
957128860 3:76198146-76198168 CACCATGTCCTGAGGGAAGAGGG - Intronic
957128871 3:76198199-76198221 CACCATGTTCTGAGGGAGGAGGG - Intronic
957128884 3:76198252-76198274 CACCATGTCCTGAGGGAGGAGGG - Intronic
957784280 3:84861033-84861055 CAACATTCTCTTAGGGAAGAAGG + Intergenic
958882331 3:99686954-99686976 CAGCACTTTGGGAGGGAGGCAGG - Intronic
959500425 3:107100343-107100365 CAGCACAGTGTGAGGGAGGAGGG + Intergenic
960152215 3:114261948-114261970 AAGCATTGCCTGAGGCAGGATGG + Intergenic
962313438 3:134342215-134342237 TAGCATCTTCAGAGGGAGCATGG + Intergenic
962362214 3:134752045-134752067 CAGCATGTGTTGAGGGTGGATGG + Intronic
962756115 3:138466810-138466832 CAGCATTTACTCAGGGCAGAAGG + Intronic
962967225 3:140366203-140366225 CAGCAGTTTCTGGGAGGGGAGGG - Intronic
962979127 3:140472065-140472087 TAGCATTCTCTGTGGGAGGTAGG - Intronic
963358454 3:144239758-144239780 CAGCATTTTCTCTGGAATGAGGG - Intergenic
964507662 3:157417278-157417300 CAGCATTCCCTGAGTCAGGAAGG - Intronic
966631767 3:182084127-182084149 CCGCATGCTCTGAGGGAAGAGGG - Intergenic
967046119 3:185738588-185738610 AAACATTTTCTGAGAGAGGATGG - Intronic
967546650 3:190737822-190737844 CAGCTTTGACTGAGAGAGGATGG + Intergenic
967878594 3:194283044-194283066 GAACACTTGCTGAGGGAGGAAGG + Intergenic
968213317 3:196867740-196867762 CAGCGCGTTCTGAGGGAGGCCGG + Intergenic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969339847 4:6533330-6533352 CAGCCTTGTTTGAGGGAGGCTGG - Intronic
969634627 4:8359769-8359791 AAGCATTGCCTGAGGCAGGATGG - Intergenic
969669046 4:8579738-8579760 CAGCCCTTTCTGAGGGACAAAGG - Intronic
971286258 4:25292797-25292819 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
971444011 4:26722958-26722980 CAACATCTTCTGAGGCAGTAGGG - Intronic
974435183 4:61847373-61847395 CAGCAGTGTATGGGGGAGGAGGG + Intronic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
975567145 4:75769499-75769521 AAGAATTTTCTGAGGGATAATGG + Intronic
977180335 4:93866196-93866218 CAACATTGCCTGGGGGAGGAGGG - Intergenic
977555743 4:98485889-98485911 CTTCATTTGCTGAGGAAGGATGG - Intronic
978069936 4:104454609-104454631 CTGCATGTTCTGAGGGATCAGGG - Intergenic
978070720 4:104464664-104464686 CAGAATGTTCTGAGGTGGGAGGG + Intergenic
979964030 4:127055797-127055819 CAGGATCTTCTGTGGGATGAAGG - Intergenic
982219807 4:153114780-153114802 CACCATTTTCTGAGGACCGATGG - Intergenic
983160122 4:164402963-164402985 CAGCACTTGCTGAGGGAGTGCGG + Intergenic
984196093 4:176659915-176659937 AAGAATTTTCAGAGGGAGCATGG - Intergenic
984709660 4:182874631-182874653 AATTAATTTCTGAGGGAGGACGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986801942 5:11269780-11269802 CTGCATATTCTGAGGGGGGAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
990662626 5:58034529-58034551 GAGTATTTTCTGTGGGAGGTGGG - Intergenic
990682257 5:58258189-58258211 CTGCATTTACTGAGGCAGGGTGG + Intergenic
990855871 5:60265757-60265779 CAGCATTTTTTGAAGGAGCAAGG - Intronic
991131671 5:63129833-63129855 CAGAATTTTTTGAGAAAGGAAGG - Intergenic
991412487 5:66358740-66358762 CAGCATTTGCTGAAGCAGGTTGG + Intergenic
992944239 5:81794039-81794061 CATCCAGTTCTGAGGGAGGAAGG - Intergenic
993026631 5:82654429-82654451 AAGAATTTTCTGAGGTAGGATGG - Intergenic
994422546 5:99539278-99539300 CAGCATTTTGGGAGGCAGGTGGG - Intergenic
994459827 5:100058225-100058247 CAGCATTTTGGGAGGCAGGTGGG + Intergenic
995355079 5:111227965-111227987 AAGGCTTTTCTGAGGGAGAAGGG + Intronic
996608292 5:125349711-125349733 CAGCTTTTTCTGTGGTAGGATGG + Intergenic
996764203 5:127019403-127019425 CATCATTGCCTGAGGGAGGGAGG - Intronic
997103501 5:130994014-130994036 TAGCAGTTTCTGAGATAGGAAGG + Intergenic
997263492 5:132481225-132481247 CAGGAATGTCTGAGGGTGGAAGG - Intergenic
997389926 5:133506114-133506136 CAGCATTTTCTGTAAGAGGTGGG - Intronic
998036448 5:138920933-138920955 CAGCATTTTATGAGGCTGTAGGG + Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
999291759 5:150430424-150430446 CAGGATTTGCCGTGGGAGGAAGG + Intergenic
999409217 5:151335720-151335742 CAGCCTCTTCTGAGGTAGTATGG - Intronic
999689278 5:154132790-154132812 CAGCATTGATTGAGTGAGGAAGG + Intronic
999833400 5:155342163-155342185 CATCATTTTCTCAGGTAGGGTGG - Intergenic
1000028885 5:157384617-157384639 CACCATTTTCAGAAGGAGGTTGG - Intronic
1000117599 5:158167943-158167965 CAGCACTTGGTGATGGAGGAGGG + Intergenic
1000887515 5:166763930-166763952 CAGCATTTTCAGAGGCCGAAGGG - Intergenic
1003066966 6:2912078-2912100 CAGCAGTTTATTAAGGAGGAGGG - Intergenic
1003333768 6:5151622-5151644 CAGCATGTTCTAATGGAGAAGGG + Intronic
1006152233 6:31995733-31995755 CAGCAGTTTCGGAAGGCGGATGG + Exonic
1006158535 6:32028471-32028493 CAGCAGTTTCGGAAGGCGGATGG + Exonic
1006919296 6:37616911-37616933 CAGCATTTCTGGAGGAAGGATGG - Intergenic
1006919379 6:37617387-37617409 CAGGATTTGGTGAGGAAGGAAGG - Intergenic
1007369259 6:41415462-41415484 CAGCATCTTGTGGGGGAGGAGGG + Intergenic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1008225861 6:48915576-48915598 GCACACTTTCTGAGGGAGGAGGG + Intergenic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009417116 6:63428205-63428227 CAGCATTTTAGTAGGGAAGAAGG - Intergenic
1009747797 6:67841512-67841534 GAGCCTTTTCAGAGGGTGGAGGG - Intergenic
1011259826 6:85459209-85459231 CAGCATTTTGGGAGGCAAGAAGG - Intronic
1011810811 6:91130216-91130238 CAGCATTTTCTCTGTGAGCATGG + Intergenic
1015281010 6:131434011-131434033 CAGCATTGTCAGAGGTGGGAGGG - Intergenic
1017161002 6:151366033-151366055 CAGCAATGTCTGAGGGGGGTGGG + Exonic
1018122738 6:160652765-160652787 CAACATTTTGAGAGGGAGGAAGG + Intronic
1018236704 6:161733001-161733023 CAGCATTTTCTGAAGTAGAAAGG - Intronic
1018622783 6:165747910-165747932 CAGCATTTTCCGTGGCAGAAAGG + Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019596432 7:1860552-1860574 AAGCGTTTTGTGAGGGACGAGGG - Intronic
1019774629 7:2905354-2905376 CAGGATTCTCTTAGGAAGGAAGG + Intergenic
1019961189 7:4461328-4461350 CAGCTTTCTCTGGAGGAGGAGGG - Intergenic
1020614292 7:10439275-10439297 CAGCATTCTCTGAGGAACAAGGG - Intergenic
1021654353 7:22860456-22860478 CATAATTTTCTAATGGAGGAGGG + Intergenic
1022734164 7:33060713-33060735 GAGATTTTTCTGAGGGAGGAGGG + Intronic
1023540100 7:41255667-41255689 CATCATTTTCTTTAGGAGGAAGG + Intergenic
1024430812 7:49285897-49285919 CAGGACTTACTGAGGAAGGAGGG + Intergenic
1024692539 7:51818782-51818804 CTGCATTTTCTGAGGCACGTGGG - Intergenic
1025983047 7:66423671-66423693 CATCATCTTCAGGGGGAGGAGGG + Intergenic
1026161102 7:67869659-67869681 CAGGATTTTATTAGGAAGGAAGG + Intergenic
1026290545 7:69001995-69002017 TAGAATTTTCTGAGTGATGAAGG + Intergenic
1026338911 7:69418879-69418901 CAGCATTTTGGGAGGCAGAAGGG - Intergenic
1028714233 7:93946215-93946237 CAGCATATTTTTAGTGAGGAGGG - Intergenic
1030549352 7:110938425-110938447 CAGCATTTTCTGAGCTAGACTGG + Intronic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032671781 7:134090580-134090602 AAGCATTTCCTGAGGCAGGGTGG + Intergenic
1034383085 7:150716135-150716157 TATCATTCTCTGAGAGAGGAGGG - Intergenic
1037847728 8:22298810-22298832 CAGCATCTTCTGAGGAAGGGTGG + Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1040458936 8:47628154-47628176 AAGCATGTTCTGTGGAAGGATGG - Intronic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1041808024 8:61875027-61875049 CAGCTTTTTATGAGTGAGGGAGG + Intergenic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1043614681 8:82111260-82111282 CAGCACTGTCTGAGTAAGGAAGG + Intergenic
1045508532 8:102795423-102795445 CCCCTTTTTGTGAGGGAGGAGGG - Intergenic
1045879471 8:107020908-107020930 CAGCATTTTCTAGGAGAGGTGGG - Intergenic
1048023712 8:130564706-130564728 CAGCTTTTCCGGAGGGAGGGAGG - Intergenic
1049539058 8:143198541-143198563 AAGCATTTTCTGTGTGAGGCTGG - Intergenic
1050693231 9:8251828-8251850 CAGCATTTTCTGTGGCAGACTGG + Intergenic
1050743730 9:8852893-8852915 AATCATTTTGTGAGGGAGGAGGG + Intronic
1051775246 9:20624880-20624902 GAGCATTCTTTGAGGAAGGAGGG - Intergenic
1052198700 9:25750424-25750446 CAAGATTTTCTTAGTGAGGAAGG - Intergenic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1057259279 9:93575404-93575426 CGGATTTTGCTGAGGGAGGATGG + Intergenic
1057426175 9:94951502-94951524 CAGGATCTTATGAGGGAAGAGGG + Intronic
1058071719 9:100608221-100608243 CAGTTTTTTCTAAGGGAAGATGG + Intergenic
1059941259 9:119362064-119362086 CAGCACTTTGGGAGGGCGGAGGG - Intronic
1060244356 9:121931676-121931698 CAGCATGCTCTGAGGGATTAAGG - Intronic
1060985910 9:127818824-127818846 CACCTTTTTCTGGGGGAGGACGG + Exonic
1061248741 9:129414434-129414456 CAGAGTTTTCTGCGGGATGAGGG - Intergenic
1061764840 9:132875191-132875213 CAGCATGTTCTGTGGGTGCAGGG + Exonic
1062095470 9:134700947-134700969 CATCCTTGTCTGAGGGACGAGGG + Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186415603 X:9380708-9380730 GAGTATTCTCTGAGGGACGAGGG + Intergenic
1187378634 X:18780231-18780253 CAACCTTGTCTGAGGGATGATGG + Intronic
1187469933 X:19560535-19560557 CAGCACTTTGGGAGGCAGGAGGG - Intronic
1187680525 X:21762769-21762791 CAGCATCTGCTGGGGAAGGAGGG - Intergenic
1187923178 X:24225715-24225737 CAGCAGTGTATGAGGGTGGAAGG + Intergenic
1188003630 X:25003191-25003213 CGGCATGTTCGCAGGGAGGAGGG - Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1191119440 X:56888084-56888106 AAGCATTTCCTGAGGCAGGGTGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1193087638 X:77461334-77461356 CAGCCTTTTCAGGAGGAGGAAGG - Intergenic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1194040857 X:88940789-88940811 GAGCATTGCCTGAGGCAGGATGG + Intergenic
1194631463 X:96290590-96290612 CAGCAACTTCTGAGGGGTGAGGG + Intergenic
1195455132 X:105059775-105059797 CAGCACTTTGGGAGGCAGGAAGG - Intronic
1195977130 X:110539464-110539486 CAGCATTGTGAGTGGGAGGAGGG - Intergenic
1196279398 X:113805170-113805192 CAGCAATCTGTGAGGGAGGCTGG - Intergenic
1197362426 X:125522100-125522122 CAACATTCTGTGTGGGAGGAAGG - Intergenic
1198143078 X:133825505-133825527 AAGCATTTTCTTGGGGAGGAGGG + Intronic
1198844813 X:140899663-140899685 AAGCATTGCCTGAGGCAGGATGG + Intergenic
1200951073 Y:8901196-8901218 CAGTACTTCCTGAGGGAGGGAGG - Intergenic
1202181612 Y:22144722-22144744 CAGCAGTTTCTGAGGCTGTATGG + Intergenic
1202209748 Y:22441680-22441702 CAGCAGTTTCTGAGGCTGTATGG - Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic