ID: 1089455224

View in Genome Browser
Species Human (GRCh38)
Location 11:118621893-118621915
Sequence CCTCCCATATTCCCTTCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089455215_1089455224 22 Left 1089455215 11:118621848-118621870 CCTTATGGCCAAGGAGGGTCTCT 0: 1
1: 0
2: 1
3: 16
4: 336
Right 1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG 0: 1
1: 0
2: 0
3: 26
4: 240
1089455217_1089455224 14 Left 1089455217 11:118621856-118621878 CCAAGGAGGGTCTCTGATAGGAA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG 0: 1
1: 0
2: 0
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089455224 Original CRISPR CCTCCCATATTCCCTTCACT CGG Intronic
901188487 1:7389805-7389827 CCTCCAAGATTCCCTTGCCTGGG - Intronic
901209195 1:7515001-7515023 CCTCCCCTGCTCCCTTCACCTGG + Intronic
902546711 1:17194847-17194869 GCCCCCACATTCCCTTCCCTGGG - Intergenic
902965154 1:19995780-19995802 CCTCACAGATTCCCTTGGCTGGG + Intergenic
905182035 1:36173253-36173275 CCTCCCCCACTCCCTTCCCTTGG - Intronic
905266254 1:36756200-36756222 CCTCCCATTTGCCCCACACTAGG + Intergenic
905311712 1:37053440-37053462 CCTCCCATCTTCCCAGGACTGGG - Intergenic
906089113 1:43162865-43162887 CCTCTCATATTCCTTTGATTAGG - Intergenic
906276019 1:44516614-44516636 CCTCCCATCTTCCTTTCTCTTGG - Intronic
906931032 1:50169601-50169623 CCAGGCATATTCCATTCACTAGG - Intronic
908031954 1:60010240-60010262 ACCCCCATTTTTCCTTCACTGGG + Intronic
909520150 1:76558592-76558614 CCTCCCATTCTCCCTACTCTAGG - Intronic
911162471 1:94694851-94694873 ACTCCCATATTTCCTTCTTTCGG + Intergenic
912434922 1:109655019-109655041 CCTACCATATTCCAGGCACTGGG - Intergenic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
914667829 1:149846581-149846603 CCAGCCATAGTCCCTTCACCTGG + Intronic
915251144 1:154589581-154589603 ACTCCCATATTCTCTCCTCTAGG + Intronic
915992334 1:160530190-160530212 CCTCCCAGCTTCCCTTGGCTAGG + Intergenic
916069562 1:161161901-161161923 TCTACCCTATTCCCCTCACTAGG - Intronic
917246766 1:173011522-173011544 CATCCCACTTTCCCTTCATTTGG - Intergenic
918131717 1:181635266-181635288 CCTCCCACAACCCCTTCTCTAGG - Intronic
919182045 1:194098676-194098698 CCTCCCAACTTCCCTTCTTTTGG + Intergenic
919613180 1:199772254-199772276 CCACCCAGATTCCCTTTACCAGG - Intergenic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
921221658 1:212978125-212978147 CCTCCCAGAATGACTTCACTGGG - Intronic
922190776 1:223316655-223316677 CCTCCCTTTTGCCCTCCACTGGG - Intronic
922359290 1:224806508-224806530 ATTCCCATATACCCTTCACTCGG + Intergenic
922924364 1:229335557-229335579 CACCCCATTTTACCTTCACTGGG - Intronic
923150869 1:231232212-231232234 CCCCCCATATTCTCTGCAGTAGG + Intronic
923325988 1:232880600-232880622 TCTCCCATACTCCATGCACTTGG + Intergenic
1062842658 10:683109-683131 CCTCTCATTTTCCCTTCGCTGGG - Intronic
1063144799 10:3287284-3287306 ACTCCCATAATCCCAGCACTTGG + Intergenic
1067377768 10:45743582-45743604 ACTCTCATATACCCTTCACCTGG + Intronic
1067852759 10:49765013-49765035 ACTCCCATAATCCCAGCACTTGG - Intergenic
1067885468 10:50084264-50084286 ACTCTCATATACCCTTCACCTGG + Intronic
1068645950 10:59468351-59468373 CAACCAATATTCCCTTCAATAGG + Intergenic
1071383662 10:85098095-85098117 CCACCCATATCCTCTTCTCTGGG + Intergenic
1072723459 10:97796034-97796056 ACTCCCATATTGCCTGCACCTGG + Intergenic
1073212859 10:101818659-101818681 CCTCCCATACTCCCCTCCTTCGG - Intergenic
1073815878 10:107206166-107206188 CCTCCCACATTACCTTGACTCGG - Intergenic
1074144634 10:110706169-110706191 CCTACCTTATTGCCTGCACTGGG + Intronic
1074753350 10:116607576-116607598 CCGATCATATTCCCTGCACTTGG - Intronic
1074756852 10:116630041-116630063 TCTCCCATAGTTCCTTCCCTAGG + Exonic
1074868355 10:117558092-117558114 GCTCACCTATTCCCTTCCCTGGG - Intergenic
1075609075 10:123836856-123836878 CCACCAATTTTCCCTTCACCTGG + Intronic
1075929634 10:126284870-126284892 GCTCCCTTACTCTCTTCACTGGG + Intronic
1078331552 11:10426308-10426330 CCTCACGGTTTCCCTTCACTAGG + Intronic
1078873998 11:15375848-15375870 CTTCCCATTCTCCCTTCACAAGG - Intergenic
1079345345 11:19646934-19646956 CCTCCCATACTCCCTCTCCTAGG + Intronic
1079405138 11:20138451-20138473 CCTCCCATATCCCCTCCACAAGG + Intergenic
1079610224 11:22423916-22423938 CTTTCCATATTGCCTTTACTGGG - Intergenic
1082262168 11:50084880-50084902 CCACCCATAATCCCAACACTGGG + Intergenic
1084365955 11:68699150-68699172 CCACCCATATGTCCTTCAATGGG + Intergenic
1084731937 11:71079378-71079400 ACTCCCATATGCCCTCCACGCGG - Intronic
1085697141 11:78714690-78714712 CCTCCCATCCTCCCTACACCTGG + Intronic
1085699788 11:78735810-78735832 CCTCACACATTCCCTTGTCTTGG + Intronic
1086584496 11:88435030-88435052 CGACCCATATTTCCTTCAGTAGG + Intergenic
1087395798 11:97596032-97596054 CCTCCCCTGTTCCCACCACTTGG - Intergenic
1089169734 11:116503649-116503671 CCTCCTCTGTGCCCTTCACTTGG + Intergenic
1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG + Intronic
1090048439 11:123357097-123357119 CCTCCCAAATGCCCTTCCCTCGG - Intergenic
1090688806 11:129155989-129156011 CCTCACATCTTCCCTTGGCTAGG - Intronic
1092178935 12:6431521-6431543 CCACCCATTTTCTCTCCACTCGG - Intergenic
1095230562 12:39734134-39734156 CCTCACAGCTTCCCTTGACTAGG + Intronic
1096665183 12:53159791-53159813 CCTGCCCTTTTCCCTCCACTAGG + Intronic
1099658136 12:85521635-85521657 CCTCCCATATTTACTCCTCTGGG + Intergenic
1099896650 12:88656236-88656258 TCTCACATATTCCTTTTACTTGG + Intergenic
1100392814 12:94158816-94158838 CCTCCCATGTTCCCAGCGCTTGG - Intronic
1101259211 12:103012237-103012259 CCTCCCAGAATCCTGTCACTAGG + Intergenic
1101718650 12:107332523-107332545 CATCCCATATTCCCTCCTCAAGG - Intronic
1101896551 12:108761408-108761430 CCCCCCAGATTCCATTCTCTAGG - Intergenic
1102119464 12:110429344-110429366 CCTTCCCTAGTCCCTGCACTAGG - Intergenic
1102738770 12:115187431-115187453 CCTCCTATATCCACTTTACTAGG + Intergenic
1105723036 13:23135130-23135152 CCTTCCCTAGTCCCTGCACTAGG + Intergenic
1106885380 13:34179135-34179157 CTTCCCATATGCCCTGCACCAGG + Intergenic
1107778057 13:43868252-43868274 GCTCCCAAATTCCCTGCAGTAGG + Intronic
1108089325 13:46830355-46830377 CATCCCATATGCCATTCCCTTGG - Intergenic
1109661668 13:65467647-65467669 CCTCACAGATTCCCTTGGCTAGG + Intergenic
1110714968 13:78691302-78691324 CCACCTATATTGCCTTCATTTGG - Intergenic
1111781308 13:92729094-92729116 TTTCCCCTATTCTCTTCACTTGG + Intronic
1112391867 13:98992403-98992425 CCTCCCAGCTTCCCTTCAGTTGG + Intronic
1114490598 14:23099287-23099309 CCTCCCTTATTCCTCTAACTGGG + Exonic
1115642190 14:35341884-35341906 CCTCCCAGCCTCCCTTCACTGGG + Intergenic
1116771543 14:49132015-49132037 CCTCACGGCTTCCCTTCACTAGG + Intergenic
1118748506 14:68790640-68790662 CCTCCCATAGGCCATTCACCTGG + Intronic
1120441602 14:84547830-84547852 GCTCACATATGCCCTTCTCTTGG - Intergenic
1121265938 14:92602702-92602724 TCTCCCAAATTCCCAGCACTGGG - Intronic
1121280998 14:92698022-92698044 TTTCCCCTATTCCCTTCAGTGGG - Intergenic
1122118785 14:99540897-99540919 CATCCCAGATACCCTGCACTGGG + Intronic
1125753040 15:42043342-42043364 CCTCACATATTTCCCTCACTAGG - Intronic
1128394570 15:67211065-67211087 CCTTCCTTCTTCCTTTCACTTGG + Intronic
1129408650 15:75336658-75336680 CCTCCGATTTCCCCTTCCCTTGG - Intronic
1129851983 15:78798673-78798695 CCTGCCAGCTTCCCTTCTCTGGG - Intronic
1130251016 15:82300414-82300436 CCTGCCAGCTTCCCTTCTCTGGG + Intergenic
1130792054 15:87165745-87165767 CTTCTAATAATCCCTTCACTAGG + Intergenic
1131885704 15:96910260-96910282 CCTCCCATTTTCCCTTACTTGGG - Intergenic
1132225474 15:100137659-100137681 CCTCGAATATTTCCTTTACTTGG - Intronic
1133727572 16:8551834-8551856 CCACCCAAATGTCCTTCACTAGG + Intergenic
1133759532 16:8787379-8787401 ACTCCCATAATCCCAGCACTTGG + Intronic
1135484437 16:22851777-22851799 ACTCCCATCTCCCCTCCACTGGG + Intronic
1137524122 16:49218911-49218933 CCCCCAAAATTGCCTTCACTGGG + Intergenic
1137624325 16:49898146-49898168 CCTCCCATGCCTCCTTCACTGGG + Intergenic
1138248843 16:55487313-55487335 CCTCCCAAATTCCCCTGACAAGG - Intronic
1138769513 16:59647391-59647413 CTTCCCAGATATCCTTCACTGGG - Intergenic
1140997847 16:80278483-80278505 CCTTCCAGATTCAATTCACTAGG + Intergenic
1141946106 16:87311078-87311100 CCTCCCATCTCCCCTTCCCCCGG + Intronic
1142177183 16:88650698-88650720 CCTCCCCCATTCCCTTCTCTCGG - Intronic
1142466663 17:140855-140877 CCACCCATGTTCCCCTCACCAGG - Intergenic
1142466798 17:141185-141207 CCACCCATGTTCCCCTCACCAGG - Intergenic
1142466937 17:141534-141556 CCACCCATGTTCCCCTCACCAGG - Intergenic
1146256461 17:31393723-31393745 ACTCCCATTTTCCCTTCTCCAGG + Intronic
1147584248 17:41644236-41644258 GCTCCCATATGCCCATCACCCGG - Intergenic
1147936016 17:44011634-44011656 CCTGCCATACTCCCTTCTCAGGG + Exonic
1148051232 17:44770853-44770875 GCTCCTATAATCCCATCACTGGG + Intronic
1150833213 17:68541768-68541790 CCTTCCATATACCCAACACTAGG - Intronic
1151846720 17:76661324-76661346 ACTCCCATCTGCCCTTCACCCGG - Intergenic
1155384864 18:25266664-25266686 CCTCACATCTTCCCTTGGCTAGG - Intronic
1156498890 18:37544431-37544453 CCTCCCAGAGTCCATTCAGTGGG - Intronic
1156744504 18:40372486-40372508 CCTCCCATTCTCCCTTTCCTGGG + Intergenic
1157564207 18:48668711-48668733 CCTCCCAAATTCCCTGTGCTTGG + Intronic
1158310479 18:56152520-56152542 CCACCCTGATTCCCTTCCCTGGG + Intergenic
1158340122 18:56457204-56457226 ATTCCCATATTCCCATCAATTGG + Intergenic
1160285870 18:77542718-77542740 CCTCTCAGATTCTCTCCACTGGG - Intergenic
1160672141 19:370690-370712 CCACCCAAATACCCTTCAGTGGG + Intronic
1162828600 19:13269994-13270016 CTTCCCCTATTCCCTTCCCCTGG + Intronic
1163173440 19:15548708-15548730 CCTCCCACATTCCCTCCTCCAGG - Intronic
1164767075 19:30780449-30780471 CCTCCCAGATTTCCTGCCCTGGG + Intergenic
1165585164 19:36908696-36908718 CCTCCCATTTTCCCCTCTCTTGG - Intronic
1166303085 19:41922980-41923002 CCCCTCACATTCCCTTCACCTGG - Intronic
1166547670 19:43643348-43643370 CCTGCCATATTCCAGGCACTAGG + Intergenic
925505250 2:4555071-4555093 CTTCCCATTTGCCATTCACTGGG - Intergenic
928013176 2:27629524-27629546 CCTGTCATGTTCCATTCACTGGG + Intronic
928018336 2:27680143-27680165 CCTCCCAGATTCCCTTTATCAGG - Intronic
929859733 2:45666552-45666574 TCTCCCATATCCCCATCCCTGGG + Intronic
930166086 2:48204998-48205020 CCTCCCTTATTCCCATAATTGGG - Intergenic
930900468 2:56500694-56500716 CCTCCCATGTTGGCCTCACTTGG + Intergenic
932757287 2:74417525-74417547 CCTTCCCTAGTCCCTGCACTAGG - Exonic
932921646 2:75921540-75921562 CCTCCCCTTTTCCCTTCCCCAGG - Intergenic
933323994 2:80812837-80812859 TCTCACATACTCCCTTCACTTGG - Intergenic
934150417 2:89143041-89143063 CATCCCATGTTCCCCTCACCTGG + Intergenic
934155325 2:89194198-89194220 CCCCGCATATTCCCCTCACCTGG + Intergenic
934211997 2:89988548-89988570 CCCCGCATATTCCCCTCACCTGG - Intergenic
934216876 2:90038990-90039012 CATCCCATGTTCCCCTCACCTGG - Intergenic
937562656 2:123244688-123244710 CCTCACATCTTCCCTTGGCTGGG - Intergenic
939554763 2:143661033-143661055 CCTCCCACATTCCCTAAACTGGG + Intronic
939611129 2:144312365-144312387 CCGCCCACAGTCCCTTCACATGG + Intronic
942112218 2:172693771-172693793 AAGCCCATATTCCCCTCACTTGG + Intergenic
944663747 2:201941950-201941972 CCTCCTGCACTCCCTTCACTCGG - Intergenic
945144947 2:206728349-206728371 CCTCTCTTACTCCCTACACTGGG + Intergenic
946334621 2:219028727-219028749 CCCCCCATATTCTCCTCCCTTGG - Intronic
946616846 2:221519115-221519137 CCTCCCACATACAATTCACTTGG + Intronic
947070969 2:226287734-226287756 CCACCCAGATTCCCTTTACTGGG + Intergenic
1168907980 20:1422058-1422080 CATCACATATGCCCTCCACTGGG + Intergenic
1174119949 20:48257183-48257205 CTTCCCATACACCCTACACTAGG - Intergenic
1175318048 20:58065598-58065620 CCAGCCACATTCCCTTCACCTGG + Intergenic
1175435754 20:58946414-58946436 ACTCCCATTTTCCTCTCACTAGG + Intergenic
1177094500 21:16815823-16815845 CCTCCCATACTAACTACACTGGG + Intergenic
1178007048 21:28233962-28233984 CCTCACAGATTCCCTTGGCTAGG - Intergenic
1178897531 21:36571745-36571767 CCTGCCAAATTCCATTCTCTCGG + Intronic
1179104242 21:38384019-38384041 CCGCCCACATTCCCTTCACCAGG + Intronic
1181874386 22:25928589-25928611 TCTCCCAGTTTCCCTCCACTGGG + Intronic
1182046999 22:27283128-27283150 CCTCCCATATTCCCTGAAGGAGG - Intergenic
1183380195 22:37486721-37486743 TCACCCACATTCCCTCCACTAGG + Intergenic
954051869 3:47986067-47986089 CCTACCATGTACCCTTTACTTGG - Intronic
955657898 3:61264042-61264064 CCTCACAGCTTCCCTTGACTAGG + Intergenic
956850021 3:73220354-73220376 CCTCTCATCTCTCCTTCACTAGG + Intergenic
960280318 3:115774383-115774405 AATCCCATATTCCCTTTACTTGG + Intergenic
961977451 3:131042016-131042038 CCTCACAGCTTCCCTTCGCTAGG - Intronic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
962968771 3:140379575-140379597 CCTCCCATGTTCCCTTCCCCAGG - Intronic
964829858 3:160872410-160872432 CCTCCCATATGCCCCATACTAGG + Intronic
966228216 3:177620995-177621017 CCTGCCTTCTTCCCTTCACCAGG + Intergenic
970403889 4:15743810-15743832 GCTCCCATCTTCCCTTTCCTGGG - Intergenic
971761693 4:30773946-30773968 CATCCCATATTCCATTTAGTGGG + Intronic
972160846 4:36225474-36225496 CCTTCCTTATCACCTTCACTTGG - Intronic
973805652 4:54523601-54523623 GCTCCCATATCCCCATCACCTGG - Intergenic
975329716 4:73099730-73099752 CCTCCCCTAGTCCCTGCACTAGG + Intronic
975392877 4:73839664-73839686 CCTCCCATCTTTCCTTCCTTTGG + Intronic
976655985 4:87489316-87489338 CCTCACAGCTTCCCTTCGCTAGG + Intronic
978402244 4:108343110-108343132 CCTCCCTAAATCCCTCCACTTGG + Intergenic
982387858 4:154832217-154832239 CCTGCCATACTACCATCACTTGG + Intergenic
985307039 4:188554789-188554811 CCTCCTAAATGTCCTTCACTAGG - Intergenic
985371020 4:189285067-189285089 CCTCCCATCATCCCTTCAGGGGG + Intergenic
986143136 5:5050303-5050325 CTTCACATAATCCCTGCACTAGG - Intergenic
989422469 5:41255756-41255778 CCACTCATATTCCCTTCTCTGGG - Intronic
990526563 5:56633997-56634019 CCTACCACATTGCCTTCAATGGG + Intergenic
991488156 5:67159474-67159496 CCCCCCAACTCCCCTTCACTTGG + Intronic
993002588 5:82396537-82396559 CCTCACAGATTCCTTTCTCTTGG - Intergenic
997286064 5:132679466-132679488 CCTCCCAGTTTCCTTTCTCTTGG - Intronic
998900625 5:146849676-146849698 ACTGTCATTTTCCCTTCACTGGG - Intronic
999320715 5:150613419-150613441 CCTGCCTTCTTGCCTTCACTGGG + Intronic
1000352121 5:160360179-160360201 TCACCCATATTCACTTTACTTGG + Intronic
1000406418 5:160892960-160892982 CCTCACAGCTTCCCTTGACTAGG - Intergenic
1001449368 5:171812441-171812463 CCACCCATCTTACCTTCATTAGG + Intergenic
1001594661 5:172890513-172890535 GTTCCCATACGCCCTTCACTGGG - Intronic
1001681269 5:173558793-173558815 CCTCCCATTTTCCCATCTCCAGG + Intergenic
1002669868 5:180857929-180857951 ACTTCCATATACCCATCACTTGG - Intronic
1003400652 6:5787756-5787778 GCTCCCATATACCGTTCACCCGG + Intergenic
1003624753 6:7730428-7730450 CCCCTCATATTCCTATCACTGGG + Intronic
1003858795 6:10302704-10302726 ACTCCCACCTTCCCTCCACTAGG - Intergenic
1006185077 6:32176967-32176989 ACTCCCATTATCCCTTTACTAGG + Exonic
1008169824 6:48189419-48189441 AGTTACATATTCCCTTCACTAGG + Intergenic
1008723528 6:54388557-54388579 CCTCCCATTTACCCTACCCTGGG - Intronic
1011206020 6:84899026-84899048 CCACCCATCTTCCCTCCACCAGG + Intergenic
1012753630 6:103193877-103193899 CCTCCAATATTGCCTACCCTTGG - Intergenic
1013527595 6:110989318-110989340 ATTCCCATATACCCTTCACCTGG + Intronic
1013612866 6:111811561-111811583 CCACCCTTATCCCCTTCTCTGGG + Intronic
1013741883 6:113297136-113297158 GCTCACATTTTCCCTTCACAGGG + Intergenic
1015743262 6:136481940-136481962 ATTCCCATGTACCCTTCACTTGG - Intronic
1017800192 6:157888728-157888750 CCTGACATAATCACTTCACTTGG - Intronic
1019127962 6:169853818-169853840 CCTCCAATTATCCCTTCACAGGG - Intergenic
1019602918 7:1894267-1894289 CCTCCGAGCTGCCCTTCACTGGG - Intronic
1020721432 7:11750512-11750534 CCTCCAATATTGCCATCACTTGG - Intronic
1020792160 7:12640896-12640918 CCTCCCATATTTGTTACACTTGG - Intronic
1021788088 7:24172631-24172653 CTTTCCATTTTCCCTTCTCTTGG + Intergenic
1025184323 7:56845346-56845368 CCACCCATAATCCCAACACTGGG + Intergenic
1025687605 7:63731622-63731644 CCACCCATAATCCCAACACTGGG - Intergenic
1026497780 7:70918734-70918756 ACTCCTATATTCCCAGCACTTGG + Intergenic
1030267507 7:107635425-107635447 CCTCCCACATACCCTTTTCTTGG + Intergenic
1031262917 7:119545637-119545659 CCTCCCACATTTCCTCCATTTGG + Intergenic
1031461857 7:122061058-122061080 CCTCCCATCTTCTGTTCTCTAGG + Exonic
1031824515 7:126546497-126546519 AGGGCCATATTCCCTTCACTTGG - Intronic
1033506028 7:142001381-142001403 CCTCCCACATTCTCTTCAGTAGG - Intronic
1036101966 8:5796389-5796411 TCTCCCTTATTCCCCTCACAGGG - Intergenic
1036663079 8:10720919-10720941 CCTTCCAAATTCCTTTCACTGGG + Intergenic
1037175952 8:15945831-15945853 CTTCCATTATCCCCTTCACTGGG - Intergenic
1037639811 8:20732241-20732263 CCACCCTTATTGCCCTCACTTGG + Intergenic
1038281859 8:26173003-26173025 CCTCTCCTATTCCCTCCTCTAGG + Intergenic
1038665622 8:29535069-29535091 TCTCCCTAATTCCCTTCATTTGG + Intergenic
1038735031 8:30161083-30161105 ACTCCCATAATCCAATCACTTGG - Intronic
1039282909 8:36006327-36006349 CCTCCCAGTTTCCCTTGGCTAGG - Intergenic
1039846698 8:41330546-41330568 CCTCCCCTGCTCCCTTCCCTGGG + Intergenic
1040590436 8:48787880-48787902 ACTCCCATATTCCCTGAACTGGG - Intergenic
1043408922 8:79971519-79971541 CCTCCCATCTTCCCATCCCTAGG + Intronic
1043679804 8:83009380-83009402 CCTTTCAGAGTCCCTTCACTGGG - Intergenic
1044606813 8:94054889-94054911 CCTCCCAGATCCCCTTTACCAGG - Intergenic
1045029088 8:98117741-98117763 CCTCCTGTGTTCCCTTCTCTAGG + Intronic
1045134524 8:99200050-99200072 CCTCCCATTTTCCCAGCAATAGG + Intronic
1047636743 8:126771839-126771861 TCTCCCATGTTCCTTTTACTGGG - Intergenic
1049931472 9:461312-461334 CCTCTCATTTTCCATTCCCTTGG + Intronic
1050592970 9:7179148-7179170 TCTCCCATATTTCCTGGACTTGG - Intergenic
1051244437 9:15095445-15095467 CCTCACCTATTCCCTACTCTTGG + Intergenic
1052096657 9:24391707-24391729 CCTCACAGCTTCCCTTAACTAGG + Intergenic
1052894925 9:33737993-33738015 GCTCCCCTCTTCCCTTCAATTGG + Intergenic
1053443617 9:38135462-38135484 CCTCCCATTCTCCTTTCCCTGGG + Intergenic
1053456076 9:38233998-38234020 CCTCCCTAATGCCCTTCCCTGGG - Intergenic
1054733922 9:68731431-68731453 CCACCCATATTCCTTTATCTCGG - Intronic
1054818595 9:69499266-69499288 CCACCCTTCTTCCCTTCCCTAGG + Intronic
1056034569 9:82590148-82590170 CATCACAAATTCCTTTCACTGGG + Intergenic
1058708044 9:107653521-107653543 CCTGCCAGATTCCCTTCTCTGGG + Intergenic
1059644985 9:116256370-116256392 CCTCCTTTCTTCCCTTCACTTGG - Intronic
1060054369 9:120401157-120401179 CCTCCCACAGACCCTTTACTTGG - Intronic
1061124189 9:128663388-128663410 CCTTCCCTAGTCCCTGCACTAGG - Intergenic
1061351344 9:130067465-130067487 CCTTCCATTTTACCTGCACTGGG + Intronic
1186465299 X:9780023-9780045 CCTCCAATAGTGCCTTCTCTTGG - Intronic
1187610099 X:20933345-20933367 CCTTCCTTTTTTCCTTCACTTGG - Intergenic
1188156563 X:26748951-26748973 CCTTCCCTAGTCCCTACACTAGG + Intergenic
1190220874 X:48511664-48511686 TCTCCCAGATTCCCTTCTCCAGG - Intronic
1190625724 X:52336752-52336774 CCTCCCCTAGTCCCTTCTGTGGG - Intergenic
1192154552 X:68734169-68734191 CCTCCCAGTTTCTGTTCACTAGG - Intergenic
1192213379 X:69141750-69141772 CCTCCCACATTCCCATGAATGGG + Intergenic
1192428288 X:71096104-71096126 CCTCCCAAATTTCCTCCACCCGG - Intergenic
1193477219 X:81981671-81981693 GCTCACATCTTCCCTTGACTAGG - Intergenic
1194219934 X:91177412-91177434 CCTCCCATAATCCCTGCATGTGG + Intergenic
1197323233 X:125059947-125059969 CCTTCCATAATGCCTTCAATTGG + Intergenic
1198170617 X:134101791-134101813 CCTCCCACAGTCCCCTCACATGG - Intergenic
1200556440 Y:4641173-4641195 CCTCCCATAATCCCTGCATGTGG + Intergenic