ID: 1089459921

View in Genome Browser
Species Human (GRCh38)
Location 11:118646609-118646631
Sequence ACAGCTCCTTCACTTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089459909_1089459921 29 Left 1089459909 11:118646557-118646579 CCAAGTCAGTGTAGAGGTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 93
Right 1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG 0: 1
1: 0
2: 0
3: 14
4: 162
1089459918_1089459921 -2 Left 1089459918 11:118646588-118646610 CCTTGGGAGCAGAGAGGGCTGAC 0: 1
1: 0
2: 5
3: 26
4: 253
Right 1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089459921 Original CRISPR ACAGCTCCTTCACTTGGGCA CGG Intronic
900405729 1:2492166-2492188 ACAGCACCCTCACTTGGCCAGGG - Intronic
902410357 1:16208325-16208347 ACAGGCCCTTCCCTTGGGCATGG - Intronic
903229094 1:21911220-21911242 ACAGCTGCTGCCCTTGGGGAGGG - Intronic
905912589 1:41664149-41664171 ACAGGTCCTTCTCTTGAGCAGGG + Intronic
906344391 1:45006115-45006137 ACAGCTCTGTCTCTGGGGCAGGG - Exonic
911120801 1:94294395-94294417 CCAGCTACTTCACTTGAGCCTGG - Intergenic
912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG + Intergenic
916899427 1:169204190-169204212 ACAGATCCCTCACTTGGACAAGG - Intronic
920494646 1:206446180-206446202 TCAGCTCATTCACGTGGGCTTGG - Exonic
921421551 1:214954701-214954723 ACTGCTCCTACACTTGTGCTTGG + Intergenic
922569318 1:226624538-226624560 ACAGCACCTGGGCTTGGGCAGGG - Intergenic
922891901 1:229068092-229068114 CCAGCCCCTTCACTGAGGCAGGG + Intergenic
923803482 1:237233136-237233158 ACACCACCTTCACTTAGGCAGGG + Intronic
1063161046 10:3419083-3419105 ACAGCTGCTCCACTGAGGCAGGG + Intergenic
1063869864 10:10405512-10405534 ACAGCTCCCCAACTTTGGCATGG - Intergenic
1065384963 10:25125433-25125455 CCACCTCCTTCACCAGGGCAGGG - Intergenic
1065912462 10:30320727-30320749 ACAGGGCCTTAACATGGGCAGGG + Intronic
1067563552 10:47321043-47321065 GCAGCTCCATTTCTTGGGCATGG + Intergenic
1067761209 10:49048466-49048488 CCAGCTCCTTACCTTTGGCAGGG + Exonic
1068737011 10:60425193-60425215 GCAGCTCCCTCACTTGCCCACGG - Intronic
1070922256 10:80195361-80195383 AAAACACCTTCACTTGGGAATGG + Intronic
1072455186 10:95569090-95569112 GCAGCCCCTTTACTTGGGCTTGG + Intergenic
1074010680 10:109476062-109476084 CCTGTTCCTTCACTTGGTCATGG + Intergenic
1074548745 10:114423625-114423647 ACAGCTCTCTCACTTGTGCTAGG + Intergenic
1076713317 10:132350946-132350968 TCAGCTCCCTCTCATGGGCAGGG + Intronic
1078373583 11:10773590-10773612 AAAGATCCTTCATTTGGGCCGGG + Intronic
1078593696 11:12668444-12668466 ACAGCTTCTGCATTTGGGAATGG - Intergenic
1079005664 11:16789723-16789745 CCTGCTCCTTCACATGGGGAGGG - Intronic
1079144308 11:17837170-17837192 TCAGCTCCTAAACTTGGGGATGG - Intronic
1080251493 11:30238799-30238821 ACAGATTCTTCTCTTGGCCAAGG - Intergenic
1080614017 11:33930439-33930461 ACAGCTCCTTCAGTGGGGGCTGG - Intergenic
1082835858 11:57649772-57649794 TCCGCTCCTTCAATTGGGAAGGG + Exonic
1087105121 11:94400855-94400877 ACACCCCCTTCACTTTGGTAAGG - Exonic
1088828586 11:113516170-113516192 ACTGCCCATTCACCTGGGCAAGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1091397645 12:163478-163500 ACAGCACCTGCACGCGGGCAGGG - Exonic
1091643447 12:2255032-2255054 ACAGCCCCTTCACAGGGGCGGGG - Intronic
1091994419 12:4982054-4982076 GCAGCTCCCTCAGGTGGGCATGG - Intergenic
1093228518 12:16514591-16514613 ACAGCTGCTTCTCTGAGGCAGGG + Intronic
1093762296 12:22924113-22924135 ACAGGCCCTTCCTTTGGGCAAGG + Intergenic
1093895579 12:24571083-24571105 ACAGCTCCCACACTTGGAGAGGG + Intergenic
1097022091 12:56027677-56027699 AGAGCACCTTCCCTTGGGCAAGG + Intronic
1099233153 12:80050696-80050718 ACAGCCACTACACTTCGGCATGG + Intergenic
1101656311 12:106723606-106723628 AAAGCTCACTCACTTGGGCAGGG + Intronic
1102503415 12:113368577-113368599 CCTGCTCCTTCATTTGGGCTTGG - Intronic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1111255360 13:85660810-85660832 ACATCTCCCTTACTTGGGCATGG + Intergenic
1111663323 13:91237785-91237807 CCAGCTCAGTCACATGGGCAGGG - Intergenic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1120435043 14:84470813-84470835 CCAGCCCCTCCACTTGGTCAAGG - Intergenic
1121643974 14:95505128-95505150 CCGGCTCCTTCACTTGTGCTTGG - Intergenic
1122119315 14:99543417-99543439 GCAGCTCCTTCATTAGGCCAAGG - Intronic
1122747793 14:103909813-103909835 AGAGCTCCTTCACCTGTGCTGGG - Intergenic
1126453445 15:48835247-48835269 AAAACTCCTGCACCTGGGCAAGG - Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127403118 15:58612300-58612322 ACAGCTCCTCAACTTGGCCAAGG - Intronic
1129032565 15:72629463-72629485 ACAGCTTCTTCCCTGGGCCAGGG - Intergenic
1132013998 15:98300098-98300120 CCAGCTTCTCCACTTGGGCCAGG + Intergenic
1132614893 16:835519-835541 ACAGCCACCTCACTTGGGCGGGG - Intergenic
1133855709 16:9547500-9547522 ATGGCTCCATCACTTGGTCAAGG + Intergenic
1134193168 16:12138051-12138073 ACATCCCCTTCCCATGGGCATGG - Intronic
1134238665 16:12487592-12487614 CCAGCTCCTAGATTTGGGCATGG - Intronic
1134675705 16:16089029-16089051 ACAGCTGCTTCAACTCGGCAGGG + Intronic
1135593851 16:23726483-23726505 ACAGCTCTTTCATTTGGTCAAGG - Intergenic
1139327606 16:66164314-66164336 ACAGCTCCTCAAATGGGGCAGGG + Intergenic
1142016769 16:87753025-87753047 GCAGCTCCTTCCCTGGAGCAGGG + Intronic
1142433428 16:90042789-90042811 TCAGCCCCTTCCCCTGGGCAGGG + Intronic
1142849347 17:2696749-2696771 CCAGCTCCTTCACCTTGGCCAGG + Exonic
1143282333 17:5764338-5764360 ACAACTCCTTCTCTTTGGGAAGG + Intergenic
1143862028 17:9897910-9897932 ACAGATGCTTCAGTTTGGCAGGG + Exonic
1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG + Intergenic
1147371398 17:39995363-39995385 ACAGACCCTTCACTTGCCCAAGG - Intronic
1148977019 17:51538615-51538637 ACAGCACCTACAATAGGGCAGGG - Intergenic
1149232152 17:54546963-54546985 ACTGCTACTGCACTGGGGCAGGG - Intergenic
1153518851 18:5932902-5932924 ACAGCTCCATCAATAGGACATGG - Intergenic
1155441910 18:25870840-25870862 ACAGCTCCTTCAGATATGCAAGG - Intergenic
1157559769 18:48638024-48638046 CCACCTCCTGCAGTTGGGCAAGG - Intronic
1158025224 18:52887916-52887938 ACAGCACTTTCATTTTGGCAGGG + Intronic
1159189818 18:65027169-65027191 ACAGATCCCTCTCTTGGTCAAGG + Intergenic
1159687166 18:71437004-71437026 AGAGCTCCTTCCCTTGTGAATGG + Intergenic
1161217192 19:3100425-3100447 ACAGCTCAATGACATGGGCAGGG - Intronic
1161839007 19:6667378-6667400 ACACCTCCTTCCCTGGGGCCAGG + Intronic
1162001621 19:7747822-7747844 ACACCCCCTCCACTAGGGCAAGG + Intergenic
1162447237 19:10730981-10731003 GCTCCTCCTTCACCTGGGCATGG - Intronic
1164809800 19:31147128-31147150 ACAGCTTCTTCCCTAGAGCAGGG - Intergenic
1167340567 19:48913479-48913501 ACACCTCCTTCAACTGGGCTTGG - Exonic
1167571572 19:50292257-50292279 ATAGCTCCTTCATCTGGGCCTGG - Exonic
1168146882 19:54424580-54424602 TCAGCTCCTTCTCCTGGGCGAGG + Intronic
927924436 2:27000655-27000677 GCAGCTCCTTCTCCTGGTCATGG - Intronic
929517089 2:42613432-42613454 ACAGCTCCATGCCTTGGCCAGGG - Intronic
933502363 2:83130162-83130184 ACTGATCCTTGACTTGTGCATGG + Intergenic
934989531 2:98911615-98911637 CCAGCTCCTTCAGGTGGGCTTGG - Intronic
937086221 2:119173713-119173735 ACAGGTCACTCACTTGGGCCAGG + Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
942326131 2:174778545-174778567 ACAGCACCATCACTGGGGCGAGG - Intergenic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
1169049215 20:2562050-2562072 ACAGCTCCTTCTGATGGGAATGG + Intronic
1169870079 20:10240471-10240493 TCATCTCCTTCTCTTGAGCATGG - Intronic
1170901481 20:20467644-20467666 ACATCTCCTTCAAATGGGAAGGG - Intronic
1175693541 20:61083908-61083930 ACAGCTTCTTCATCTGGGAAAGG + Intergenic
1178847112 21:36183062-36183084 ACAGCTCCTGCACTCTGGCCTGG - Intronic
1178878573 21:36431016-36431038 ACAGATCCTTCCCTTGTGGAAGG + Intergenic
1179050298 21:37883434-37883456 ACAACTCATTCATTTAGGCAGGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1180840742 22:18957769-18957791 ACAGCTCCTCACCTTGGACAGGG - Intergenic
1181635538 22:24172695-24172717 ACAGATCCTTCCTTTGGGGAGGG + Intronic
1182150546 22:28024340-28024362 TCAGGGTCTTCACTTGGGCATGG - Intronic
1182269529 22:29144827-29144849 ACAGCACATTGGCTTGGGCATGG - Intronic
1184005748 22:41707286-41707308 ACAACTCCCTCACTGGGGCTGGG + Intronic
949352383 3:3137366-3137388 ACATCTCCTTCATTTGAGTAGGG - Exonic
951404480 3:22278787-22278809 AGAATTCCTTCTCTTGGGCAGGG + Intronic
952238502 3:31505743-31505765 ACATCTTCTTCACATAGGCACGG + Intergenic
953930991 3:47005552-47005574 TGAGCTCCTTCACATCGGCAGGG - Exonic
954400003 3:50314531-50314553 GTAGCACTTTCACTTGGGCAGGG - Intergenic
954465825 3:50654224-50654246 ACAGCCTCTACACTGGGGCAGGG - Intergenic
954681696 3:52349538-52349560 CCAGCTCCTTCCCTTGGCCTGGG - Intronic
954961517 3:54569496-54569518 CCAGCTCCTTCCCTTGGCTAGGG - Intronic
955791780 3:62595578-62595600 ACATCTCCTTACCTTGGGAAGGG - Intronic
957860246 3:85939215-85939237 ACAGCTGCATAACTTGGGCCAGG + Intronic
959880551 3:111440222-111440244 CCAGCTCCTTCACCTGAGTAGGG + Intronic
961032711 3:123620418-123620440 ACAGCTGCTTCTCTGGGGCTGGG - Intronic
965327106 3:167320169-167320191 ACAATTCCTTGGCTTGGGCAGGG + Intronic
967426915 3:189338010-189338032 ACAGCTTCCTCAGTTGGGCTGGG + Intergenic
967493848 3:190121502-190121524 ACCGCTTCTTCTCTTGGGGAAGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
972195621 4:36650195-36650217 ACAGTTCCTTCTCTTGGTCCTGG - Intergenic
973144866 4:46812871-46812893 ACAGCTGCTTCATTGGGCCAGGG + Intronic
976843419 4:89458489-89458511 TCTGCTCCATGACTTGGGCAGGG - Intergenic
978359003 4:107908292-107908314 ACAGCTTATTCACGTGGGTAAGG + Intronic
978833103 4:113113305-113113327 ATAGCTGCTTCTCCTGGGCAGGG + Intronic
980133221 4:128835716-128835738 GCCTCTCCTTCACTTGGACATGG - Intronic
983587914 4:169375641-169375663 ACAGCTACTCAACTTGGCCAAGG - Intergenic
984969801 4:185177890-185177912 AAAGTTACATCACTTGGGCAAGG + Intronic
985254753 4:188058654-188058676 AAAGCTCCTTCCCTTGTGAATGG - Intergenic
987751832 5:22049426-22049448 AAAGCTGCTGAACTTGGGCAAGG - Intronic
988618974 5:32803066-32803088 ACATCTCTTTCTCTTTGGCAAGG + Intergenic
990613200 5:57480645-57480667 ACAGATACTTCTCTTGTGCAAGG - Exonic
991439833 5:66635225-66635247 AGAGCTCTTTCACTCTGGCACGG - Intronic
995346615 5:111127674-111127696 ACAGCGACTTGCCTTGGGCAAGG - Exonic
995421437 5:111971808-111971830 AAAGCTCCTTCACATGGGACTGG + Intronic
995687862 5:114790845-114790867 ACACCTCTTTCACTTTTGCATGG + Intergenic
995900052 5:117054986-117055008 ACTGGTCCTCCACTTGGCCATGG - Intergenic
1000431645 5:161159638-161159660 ACAGCTTCATTACTTAGGCATGG + Intergenic
1001150694 5:169225203-169225225 ACAGGTCCATCACTGGGACAGGG + Intronic
1003223815 6:4187092-4187114 ACAGCTTCCTCATTTGGGAATGG - Intergenic
1004000780 6:11594883-11594905 CCAGCGCTCTCACTTGGGCAGGG - Intergenic
1004129403 6:12904641-12904663 ACACCTCTTTGACTTGGGGAAGG + Intronic
1004374941 6:15082990-15083012 TCAGCTCCTTCTCTTAGGAAAGG + Intergenic
1010780298 6:79938017-79938039 ACATCACCTGCACTTGGGCATGG - Intronic
1012436877 6:99224444-99224466 ACAGCTCCCTCACTTATGAAAGG - Intergenic
1014094101 6:117440863-117440885 ACAGTTGCCTCATTTGGGCATGG + Intronic
1015014200 6:128390574-128390596 AAATTTCCTTGACTTGGGCATGG - Intronic
1017034712 6:150256880-150256902 AAAGCTCCTTCATTTCTGCATGG - Intergenic
1017621999 6:156308835-156308857 ACCACTGCTTCACTGGGGCAGGG - Intergenic
1022235324 7:28455238-28455260 ACAGCTCCTGCAGTTCGGCTCGG - Intronic
1027638801 7:80708522-80708544 ACTGCAGCTTCACTTGGGTAAGG - Intergenic
1039049383 8:33479113-33479135 TCTGCTCCTCCAGTTGGGCACGG + Intronic
1041500567 8:58534566-58534588 ACATCTCCCTCATTTGGCCAGGG + Intergenic
1044643234 8:94408454-94408476 ACAGCTCCTTTGCTTGGTAATGG - Intronic
1045525264 8:102936067-102936089 ACAGCTCCTTCACGGGGTAAGGG - Intronic
1045835153 8:106511767-106511789 TCAGCTCTTACACTTGGGCAAGG - Intronic
1056860914 9:90180861-90180883 ACAGGTGCTTGAATTGGGCAGGG - Intergenic
1057200575 9:93137668-93137690 ACAGCTCCTTCAGGTGGGTGGGG - Intergenic
1057828927 9:98392473-98392495 ACAGCTCCCTCAGTTGGGATAGG + Intronic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1058816499 9:108687771-108687793 ACAGACCTTTCACTGGGGCAAGG - Intergenic
1059662285 9:116413933-116413955 CCAGCTCCTGAAATTGGGCATGG - Intergenic
1060447896 9:123708690-123708712 ATAGCACCTTCAGTTTGGCAGGG + Intronic
1187509993 X:19909049-19909071 ACAACTCCTTGACTAGGGGATGG - Intergenic
1187518075 X:19990715-19990737 TCAGCGCCTTCCCTTGGGCGCGG - Intergenic
1189240139 X:39518582-39518604 ACAGCCCCAGCACTCGGGCAAGG + Intergenic
1189260452 X:39675004-39675026 GCAGCTCCCTCACTGGGGCAGGG - Intergenic
1191111242 X:56804384-56804406 ACCCCTCCTACTCTTGGGCATGG - Intergenic
1194542891 X:95196581-95196603 CATGCTCCTTCACTTTGGCAGGG + Intergenic
1198110709 X:133500447-133500469 ACAGAGCCTTCACTAGGTCATGG - Intergenic
1198122989 X:133612502-133612524 ACAGTACCTTCAATTGGACAAGG + Intronic
1199711574 X:150473372-150473394 ACAGGTGCTTCCCTTGGGCCAGG - Intronic