ID: 1089460567

View in Genome Browser
Species Human (GRCh38)
Location 11:118650675-118650697
Sequence GTGTACATTTTCAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089460567 Original CRISPR GTGTACATTTTCAGGGAAGG AGG (reversed) Intronic
900117554 1:1034984-1035006 GTGGACTCTTCCAGGGAAGGGGG + Intronic
901462459 1:9399870-9399892 CTGAATATTTTCAGGAAAGGTGG - Intergenic
903194888 1:21678159-21678181 GTTCACATTTTCATGAAAGGGGG + Intergenic
904032634 1:27542808-27542830 GATTACATTTTCAGGAAATGAGG + Intronic
905162034 1:36045101-36045123 TTGTACATTTTCAGGGTTGGTGG + Intronic
905629167 1:39509390-39509412 GTGTAGATATTCATGGTAGGAGG + Intronic
906257846 1:44364309-44364331 GTGGACATGTTTAGGGGAGGTGG - Intergenic
907860881 1:58351910-58351932 GTTGATATTTTCAGGGAAGTTGG + Intronic
908178892 1:61584506-61584528 CTTTGCATTGTCAGGGAAGGAGG + Intergenic
908661718 1:66444344-66444366 GAGTCTACTTTCAGGGAAGGTGG - Intergenic
909056398 1:70826047-70826069 GTGAACATTTTGGGGGACGGGGG + Intergenic
909959439 1:81821316-81821338 GTATAAATTTTCAGCAAAGGCGG + Intronic
911288519 1:96027844-96027866 CTGGACATTTTCAGGGATGGGGG - Intergenic
911363023 1:96902617-96902639 ATGTTGATTTTCAGGGACGGTGG + Intergenic
911472112 1:98331862-98331884 GTGGGCATCTTCAGGGAATGTGG + Intergenic
911942961 1:104070573-104070595 GTGTACATGCTCTGGAAAGGAGG + Intergenic
912499084 1:110110060-110110082 GGAGACATTTTCAGGGAAGAAGG + Intergenic
912964254 1:114223704-114223726 GTGACCATTTTCATGTAAGGAGG - Intergenic
914749952 1:150527980-150528002 GCAAATATTTTCAGGGAAGGTGG + Intergenic
916801207 1:168218106-168218128 GTCTACAGTTAGAGGGAAGGGGG - Intergenic
920176144 1:204103075-204103097 GAATATATGTTCAGGGAAGGAGG - Intronic
920919912 1:210290124-210290146 ATGTACAGTTTCAGAGCAGGAGG + Intergenic
924419593 1:243895880-243895902 GTGTATATTTCCCGTGAAGGTGG - Intergenic
924825012 1:247530481-247530503 GTGGACTGGTTCAGGGAAGGAGG - Exonic
1063024467 10:2164316-2164338 GTGTTCACTTGGAGGGAAGGAGG + Intergenic
1063502922 10:6570971-6570993 TTGTACTTTCTCAGGGAAGCAGG + Intronic
1063617508 10:7613899-7613921 TAGTCCATTTTCAGGGATGGAGG - Intronic
1063650872 10:7935654-7935676 TTTTAGATATTCAGGGAAGGGGG + Intronic
1063810564 10:9700503-9700525 ATGTACATTTCCATGGAATGGGG + Intergenic
1065443805 10:25776736-25776758 GTGGAAATTTTCAGGAAAGCAGG - Intergenic
1065742310 10:28808125-28808147 GTTTACATTTTAATGGAGGGAGG - Intergenic
1067962193 10:50866521-50866543 GGGTCCAGTTTCAGGGAAGTTGG + Intronic
1068014508 10:51499080-51499102 GCATACTTTTTCAGGTAAGGAGG + Intronic
1068535963 10:58241827-58241849 GATTACATTTACAGGGGAGGGGG + Intronic
1069141007 10:64825557-64825579 GTATACATTTTGAAGGAAGCTGG - Intergenic
1069956062 10:72052677-72052699 GTGAACATTTTCAGGCAGTGGGG + Intergenic
1070109492 10:73470072-73470094 GGTCAAATTTTCAGGGAAGGTGG + Intronic
1070179737 10:74001900-74001922 GTGTACATTTTGACTGAAGTAGG + Intronic
1071300140 10:84250324-84250346 CAGTGAATTTTCAGGGAAGGGGG - Intronic
1071504676 10:86225492-86225514 GTGTATTTCTGCAGGGAAGGAGG + Intronic
1072702375 10:97652153-97652175 ATGTACTTTTTCTGGAAAGGGGG - Intronic
1073734678 10:106332276-106332298 GTGTCCATGTTGAGGGAAAGAGG + Intergenic
1074902182 10:117827802-117827824 GTGTACAGTCCCATGGAAGGTGG + Intergenic
1075580702 10:123616009-123616031 GTGTACATTTTCAGGTTCTGTGG - Intergenic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076615161 10:131750106-131750128 GTGTCCACTTTCAAGGAGGGTGG - Intergenic
1078054282 11:7994551-7994573 ATAGGCATTTTCAGGGAAGGGGG + Intronic
1078458689 11:11496355-11496377 GGGTCCAATTACAGGGAAGGAGG + Intronic
1079714110 11:23722726-23722748 GTGTATATTTTCAAGGAAGCAGG + Intergenic
1081710890 11:45214586-45214608 GTGTTCAGTTTGAGGGAAGCAGG - Intronic
1081803807 11:45878328-45878350 TTATCCATTTTCAGGGATGGGGG - Intronic
1083365694 11:62140344-62140366 GTGTCCTTGCTCAGGGAAGGTGG + Intronic
1085297701 11:75440171-75440193 GTGTGCACTCTCAGGGTAGGAGG + Intronic
1085958031 11:81424811-81424833 TTGTATATTGTCAGGGAATGAGG + Intergenic
1086372440 11:86168670-86168692 ATGTACAGTTTGAGGGTAGGAGG - Intergenic
1086408891 11:86524057-86524079 GTGTGACTTTTCAGGGAAAGGGG - Intronic
1088060010 11:105636256-105636278 ATGTACATTTTAAGGCAATGGGG + Intronic
1088910918 11:114191839-114191861 ATGTGCATTTATAGGGAAGGGGG + Intronic
1089343210 11:117773512-117773534 GTGTGCATTTTGAGGTGAGGAGG - Intronic
1089460567 11:118650675-118650697 GTGTACATTTTCAGGGAAGGAGG - Intronic
1090072621 11:123557349-123557371 GTGTCCATTTTGAGGGTAGCAGG + Intronic
1092955232 12:13543385-13543407 GTGAGGATTTTTAGGGAAGGAGG - Exonic
1093028316 12:14264855-14264877 CTGCACTTTTGCAGGGAAGGAGG + Intergenic
1093130152 12:15382099-15382121 GAGTATAATTTCAGGGAAGTAGG + Intronic
1094164984 12:27434764-27434786 GAGGACATTTTAAGGGAAGGGGG + Intergenic
1094686386 12:32720187-32720209 GTCTCCTTTTTCAGGTAAGGAGG + Intronic
1096546529 12:52344001-52344023 GTGTGCTCTTTCTGGGAAGGGGG + Intergenic
1100850582 12:98705962-98705984 GTTTACATATGCAGGGAAGGAGG - Intronic
1101064349 12:101004023-101004045 GTGTAGTTTCTCAGAGAAGGAGG + Intronic
1102555422 12:113723661-113723683 GGGTGCATTTTTAGGTAAGGTGG + Intergenic
1104088449 12:125494939-125494961 GCATCCATTTTCAGGGAAGAGGG - Intronic
1104833164 12:131768679-131768701 ACGAACATTTTCAGGCAAGGTGG + Intronic
1106525661 13:30539237-30539259 TTGTACCTTTTCAGCGGAGGCGG - Intronic
1106803048 13:33276168-33276190 ATCCAAATTTTCAGGGAAGGAGG + Intronic
1107575359 13:41713798-41713820 GTTTACAATTTCAAGGAATGAGG + Intronic
1108276020 13:48810390-48810412 TGGTACATTTTCAAGAAAGGTGG - Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1110723679 13:78794939-78794961 GTGCAAATGTTCAGGGAAGTGGG + Intergenic
1110723726 13:78795357-78795379 GTGCAAATGTTCAGGGAAGTGGG - Intergenic
1110947361 13:81439656-81439678 TTGTACATTTCCAGGGAAGTTGG - Intergenic
1112894771 13:104285691-104285713 GTGTACATGTTTATGGAAGCAGG + Intergenic
1113694079 13:112331635-112331657 CTGTCCAATTACAGGGAAGGGGG + Intergenic
1116391450 14:44396188-44396210 GTGTGCATTTTAAAGGGAGGGGG - Intergenic
1117033332 14:51699139-51699161 GTCTACATTTTGGGGGAAAGGGG - Intronic
1117243467 14:53859631-53859653 GGAGACATTTTAAGGGAAGGGGG + Intergenic
1119689401 14:76659295-76659317 TTCCAGATTTTCAGGGAAGGAGG + Intergenic
1120446735 14:84607634-84607656 GTGTACAGGTCCAGAGAAGGAGG - Intergenic
1121924001 14:97911499-97911521 GTGGACAGTTTCAGGGAAGCAGG - Intergenic
1124365516 15:29068567-29068589 GTGTCCATTTGTGGGGAAGGTGG - Intronic
1126705246 15:51399774-51399796 ATTTTCATTTTCAGGGAAGCTGG - Intronic
1126955635 15:53930474-53930496 GAGTAGATTTTCTGGGAAGAGGG + Intergenic
1128534329 15:68479293-68479315 GGGTGCATTTTCTAGGAAGGAGG + Intergenic
1134623571 16:15708062-15708084 ATGTACATGTTCAGGGACTGGGG - Intronic
1135166409 16:20143009-20143031 GTCTTAATTCTCAGGGAAGGTGG - Intergenic
1138086241 16:54136174-54136196 TTCTTCATTTTCAAGGAAGGAGG + Intergenic
1139648121 16:68346767-68346789 GTGTGCATTTTGGGGGATGGGGG + Intronic
1141759078 16:86015400-86015422 GTGGAAATTCTCAGGGGAGGAGG + Intergenic
1144333274 17:14244282-14244304 GTGTATATTTGGAGGGAAAGGGG - Intergenic
1148481000 17:47959367-47959389 AAGGACATTTTAAGGGAAGGGGG - Intergenic
1151848342 17:76673892-76673914 GTGGACGCTTTGAGGGAAGGAGG + Exonic
1152232321 17:79120176-79120198 CTGTACATTCTCAGAGAATGGGG + Intronic
1153403518 18:4708015-4708037 GTGTATATTTACAGTGAATGTGG - Intergenic
1155214057 18:23627110-23627132 GTTTACACTTTCAGAGAAGACGG + Intronic
1155651074 18:28142602-28142624 CTGTACATTCTCAGGGGCGGAGG - Intronic
1156522530 18:37733896-37733918 ATGTATATTTAAAGGGAAGGTGG + Intergenic
1156795785 18:41044842-41044864 TTGTACAGTTTCGGGGAAGTAGG - Intergenic
1158372218 18:56821143-56821165 GCTTACATTTTCATGGAGGGAGG + Intronic
1160246270 18:77162636-77162658 GTCTACACGTTCAGGGAATGGGG + Intergenic
1161292316 19:3501252-3501274 GTGTGCAGTTTCAGGAAGGGTGG + Intergenic
1163037332 19:14578043-14578065 GGATTCAGTTTCAGGGAAGGAGG + Intergenic
1164120448 19:22261165-22261187 GTGTACATTGTCCAGGAAAGTGG - Intergenic
1164123459 19:22288557-22288579 GTGTAGCCTTTCAGGGAAGCAGG + Intronic
1164481155 19:28611893-28611915 GTGTACATACTCTGGGTAGGTGG + Intergenic
1164496854 19:28773537-28773559 GTGTTCATTTGGAGGAAAGGAGG + Intergenic
1165882672 19:39054588-39054610 GCGTACAGTAACAGGGAAGGTGG - Intergenic
926727588 2:16010487-16010509 GTGTACATCCTGAAGGAAGGAGG - Intergenic
929367947 2:41183802-41183824 GTATAGACTTTCAGGGAAAGAGG - Intergenic
929469784 2:42179930-42179952 GTGTACATATAGAGGGAGGGAGG + Intronic
929845305 2:45519752-45519774 GTGTTGACTTTCAGAGAAGGTGG + Intronic
930157984 2:48125097-48125119 ATGCACATTATCAAGGAAGGAGG + Intergenic
930688322 2:54332222-54332244 GTTTGCATTTTCAGGTAGGGTGG - Intronic
931187482 2:59967539-59967561 GGGTGCATTTTCTGGGCAGGTGG + Intergenic
932915884 2:75857306-75857328 TAGAACATTCTCAGGGAAGGTGG + Intergenic
933491715 2:82993017-82993039 GAGTACATGTTCAGGTGAGGTGG + Intergenic
933720296 2:85393352-85393374 GTGTATATTTATAGGGAAAGGGG + Intergenic
936393553 2:112098979-112099001 GTGTCCATTTTCTGGGGTGGTGG + Intronic
936894270 2:117408861-117408883 CTGTACATCTCAAGGGAAGGGGG - Intergenic
938687408 2:133753405-133753427 GTGTACATGTTGGGTGAAGGGGG + Intergenic
939624047 2:144454822-144454844 GTGTACATTTACAGGAACGAGGG - Intronic
941933671 2:170966408-170966430 GTGTGCATCTTCGGGAAAGGTGG + Exonic
942983650 2:182112742-182112764 TTGTGCTTTTTCAGGGAAGGAGG - Intronic
944216636 2:197263096-197263118 GTGTACATTTTCAGGGGGTGAGG - Intronic
944631167 2:201626139-201626161 TTCTACATTTTTAGGGAAGCAGG - Exonic
944772103 2:202924947-202924969 GGGTACCTTCTCAGTGAAGGGGG - Intronic
945892050 2:215440102-215440124 GTGGCCATTTTCAAGGAAGAAGG - Intergenic
946028518 2:216687318-216687340 CTATATATCTTCAGGGAAGGAGG - Intronic
946065853 2:216986520-216986542 GTGTCCACTTTCAGGGAGTGAGG + Intergenic
946306004 2:218857464-218857486 GTGTATGTTTGCAGGAAAGGTGG + Intergenic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
1169553553 20:6726343-6726365 GTGTGGATTCTCAGGGAAGATGG + Intergenic
1170463311 20:16599447-16599469 ATATACATTGTCAGGGTAGGGGG + Intergenic
1170601894 20:17847622-17847644 TTGTCCACTTCCAGGGAAGGAGG - Intergenic
1170750983 20:19144847-19144869 GTGAACATCTTTAGGGAAGGGGG - Intergenic
1171116280 20:22527328-22527350 TTGAACCTTTTCAGGGCAGGAGG - Intergenic
1172035664 20:32009207-32009229 ATGTGCATTTTCAGGGAGGTGGG - Intergenic
1172860411 20:38045602-38045624 GTGTACAGTTTCAGGCACAGTGG - Intronic
1175376200 20:58525657-58525679 GTGTGCATGCTCTGGGAAGGGGG + Intergenic
1182166949 22:28184869-28184891 GGGTACAGGTTAAGGGAAGGAGG + Intronic
1184953463 22:47862685-47862707 GTGGGCAGTTTCAGGGCAGGTGG + Intergenic
951640127 3:24827529-24827551 GTTGACATTTTTTGGGAAGGAGG + Intergenic
952792462 3:37211098-37211120 GTGTATATGGTCAGGGATGGTGG + Intergenic
953881187 3:46692281-46692303 GTGCACGTTTGCAGGGCAGGAGG + Intronic
954918880 3:54172381-54172403 GTTTACATTTCCAGAGAGGGGGG - Intronic
955743409 3:62116308-62116330 GTGTAACATTTCAGGAAAGGAGG - Intronic
956393386 3:68799106-68799128 GTGAACATCTTGAGGGAGGGGGG - Intronic
957052015 3:75418349-75418371 ATGTACATTTTCTGAAAAGGTGG + Intergenic
958745544 3:98129335-98129357 TTGTACATGTCCAGAGAAGGAGG + Intergenic
958748361 3:98164696-98164718 TTGTACATGTCCAGAGAAGGAGG + Intergenic
958752140 3:98204043-98204065 TTGTACATGTCCAGAGAAGGAGG + Intergenic
958885338 3:99720334-99720356 TGGAAAATTTTCAGGGAAGGAGG + Intronic
959132578 3:102375295-102375317 CTGTACATTTTCAGAGGTGGGGG - Intronic
960616086 3:119597397-119597419 GTGTCCATTTAAAGGGAAGAAGG - Intergenic
960621726 3:119643396-119643418 GTTTGGCTTTTCAGGGAAGGTGG - Intronic
961497962 3:127307808-127307830 GTGGACATCTTCCGGGAAAGGGG + Intergenic
961885624 3:130094581-130094603 GTGTACCTTTTCTGAAAAGGTGG + Intronic
962080403 3:132133067-132133089 GTGTACATTGTATGGGATGGGGG + Intronic
962647245 3:137452620-137452642 ATGTTCATTTTAAGGGAAGCTGG - Intergenic
964668786 3:159202879-159202901 GTGTGCCTTTTGAGGAAAGGAGG + Intronic
966470308 3:180281857-180281879 CTGTCCAGTTTCAGGGAATGTGG + Intergenic
969738705 4:9008819-9008841 GTGTACATTTTAAGGGTGGCTGG - Intergenic
970652808 4:18197348-18197370 GAGTACATTTTCAGGGAGGCAGG + Intergenic
971017069 4:22499112-22499134 GTTTACTTGTTCGGGGAAGGGGG - Intronic
971669351 4:29536292-29536314 GTCTCCAGTTTCAGGGAAGAAGG + Intergenic
972215478 4:36893067-36893089 GTTTACCTTTTCTGGGAAGATGG + Intergenic
972771115 4:42197814-42197836 GTGAACTATTTTAGGGAAGGAGG + Intergenic
975995893 4:80314160-80314182 GTGTATATTTTTAGGTAAGTAGG + Intronic
976447666 4:85150486-85150508 GTATACACTTTCAGGGTAGCTGG + Intergenic
977142287 4:93388472-93388494 GTTTAAATTTTCAAGGTAGGAGG + Intronic
977345384 4:95810691-95810713 CCATACATTTTCAGGGGAGGGGG + Intergenic
977496285 4:97779024-97779046 GTGTTCCTTTGCAGGGGAGGAGG - Intronic
977890427 4:102304138-102304160 GTAAACATATACAGGGAAGGTGG + Intronic
978215198 4:106192569-106192591 GTTTCAATTTTGAGGGAAGGGGG + Intronic
978285247 4:107070149-107070171 GTCTACATTAACATGGAAGGAGG + Intronic
981857971 4:149317744-149317766 ATGTGCATTTTGAGGGATGGAGG - Intergenic
983640820 4:169942575-169942597 GTGAGGATTTTCAGGGGAGGAGG - Intergenic
984312954 4:178086860-178086882 GTGGAAATTGTCAGGAAAGGAGG - Intergenic
984935223 4:184883870-184883892 GTGGACCTTTTCCGGGAAGGTGG - Intergenic
985982998 5:3488069-3488091 GTGTTCCTGTTCAGGGAAGCTGG - Intergenic
992958756 5:81938066-81938088 GTATTCATATTAAGGGAAGGGGG - Intergenic
994096945 5:95855956-95855978 GGGAATATGTTCAGGGAAGGAGG - Intronic
994248486 5:97509185-97509207 GAGTACAATCTCAGGGAAGCAGG + Intergenic
996288957 5:121829110-121829132 ATGCAGATTTTCAGGGAAGTGGG + Intergenic
997437023 5:133882954-133882976 GTGTTCAGTTTCAGGAAACGCGG + Intergenic
998747203 5:145274145-145274167 GTATAATTTTTCATGGAAGGTGG - Intergenic
999244402 5:150146069-150146091 GTGTGCAATTGCAGAGAAGGTGG - Intronic
1000310298 5:160037012-160037034 GTGAATACTTTCATGGAAGGAGG + Intronic
1000509772 5:162166119-162166141 GTGTTCATTTGAAGGAAAGGGGG - Intergenic
1000925513 5:167189086-167189108 GTGGTCATTTTCCAGGAAGGAGG - Intergenic
1003288469 6:4756420-4756442 TTGGACATTTTAAGGGAAAGAGG - Intronic
1004269970 6:14186256-14186278 GTGTGCGTTTTCAGGGAGGGGGG - Intergenic
1004832468 6:19491913-19491935 TTTTACATTTGCAAGGAAGGGGG - Intergenic
1007422812 6:41729707-41729729 GTGGATAGTTTCAGGGGAGGTGG + Intronic
1007715051 6:43851022-43851044 GGGTACATTCTCTGGGAAGTGGG + Intergenic
1009289637 6:61867505-61867527 GTGGTCATTTGGAGGGAAGGCGG + Intronic
1011372638 6:86654263-86654285 GTGTATCTTTTCAGGGAAGGTGG - Intergenic
1011636000 6:89373981-89374003 ATGTACAGTTTTAGGTAAGGGGG - Intronic
1014244934 6:119058039-119058061 ATGTACACTTTCAGGGAATAGGG - Intronic
1014490599 6:122057170-122057192 GAGTGCATTCTCAGGGAAGAAGG + Intergenic
1017571263 6:155747640-155747662 GTGTGCATGTGCAGGGGAGGGGG + Intergenic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1019052429 6:169193289-169193311 ATGAACTTTTTCAGGGCAGGTGG + Intergenic
1019603199 7:1895594-1895616 GTGGACAGTGTCAGGGAACGAGG - Intronic
1020302851 7:6809307-6809329 CTGTACATTTTAAGTGTAGGAGG + Intronic
1022341534 7:29473028-29473050 GTATACATTCTCAGGGTAGCAGG + Intronic
1022894872 7:34740162-34740184 ATGCACATTGTCAGGGAAGTTGG + Intronic
1023480134 7:40625309-40625331 GTGAAGATTTTCAGGGCAGTAGG + Intronic
1024853230 7:53745189-53745211 GTGTTCATTTGTAGGTAAGGGGG - Intergenic
1027813965 7:82944982-82945004 GTGTACATTTTAATGAAAGGTGG - Intronic
1028572437 7:92305883-92305905 ATTTACATTTGCAGGGAATGAGG + Intronic
1028924472 7:96342666-96342688 CTGTGCATTTTCAAGGCAGGAGG - Intergenic
1030627952 7:111864416-111864438 CTGTACCTAGTCAGGGAAGGAGG + Intronic
1033200560 7:139364928-139364950 TTGTTCATTTTAAGTGAAGGAGG + Intronic
1033543371 7:142377435-142377457 GTATACAATTTCAGTTAAGGAGG - Intergenic
1033898973 7:146112851-146112873 TTGTATATTTTCAGAGAAGCAGG + Intergenic
1034759699 7:153659632-153659654 GTCTTCCTCTTCAGGGAAGGAGG + Intergenic
1036988500 8:13565383-13565405 GTGTAAATATTCAGAGAATGAGG + Intergenic
1037632637 8:20672091-20672113 CTGTCCATTGTCAGGGAAGGAGG + Intergenic
1039377663 8:37052459-37052481 GTGTCCTTTTTCTGGGAAGAGGG - Intergenic
1040103861 8:43528162-43528184 TTGTACATTTTCAGGGCATGGGG + Intergenic
1040708714 8:50162071-50162093 TTGTACAGCGTCAGGGAAGGTGG + Intronic
1042207648 8:66345235-66345257 GTGGACATTTTCTGGGGAAGGGG - Intergenic
1043494347 8:80783659-80783681 TTGTACAGGTTGAGGGAAGGGGG - Intronic
1045833299 8:106490534-106490556 GTGCATATTTTTAGGGAAGATGG + Intronic
1046777746 8:118181540-118181562 GGGTCCATTTTCAGGACAGGTGG + Intergenic
1049702358 8:144021009-144021031 GGGAAGGTTTTCAGGGAAGGAGG - Intronic
1050434111 9:5591228-5591250 ATGTACAGTGTCAGGGAAAGGGG - Intergenic
1052112000 9:24597577-24597599 GTGTACATACTCAGTGAGGGTGG - Intergenic
1052168252 9:25359920-25359942 TTGTAGATTTTCGGGGAAGGAGG + Intergenic
1053478512 9:38399153-38399175 GTGTGCATTTACAGGAATGGGGG - Intergenic
1055092942 9:72381097-72381119 GTGTTTGTTTTGAGGGAAGGTGG + Intergenic
1055682070 9:78725579-78725601 TTTTAAATTTTTAGGGAAGGGGG - Intergenic
1056198507 9:84251795-84251817 ATATACTTTTTCAGGGAAGGGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058203445 9:102072427-102072449 GTGAAAATTTTCAGGTGAGGGGG - Intergenic
1059670123 9:116483386-116483408 GTGTAAATTTACATGGATGGAGG + Intronic
1059730440 9:117051840-117051862 GTGAACATTGTCATGGAAGCTGG - Intronic
1060900245 9:127250680-127250702 GTCGAGATTTTCAGGGAGGGAGG + Intronic
1186778273 X:12887802-12887824 GAGGACATTTTCTGGGAAGCTGG - Exonic
1188170414 X:26917965-26917987 GGGTACATTTGCAGGGAATCTGG - Intergenic
1189122168 X:38406663-38406685 GGCTAAATTTTCAGGGTAGGAGG + Intronic
1189665541 X:43350957-43350979 GGGTACATTTGCAGGGAATCTGG + Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1192602149 X:72476301-72476323 GTGTACATTATCTGGGCAGGGGG + Intronic
1193551060 X:82893306-82893328 GTGCACAATCTCAGGGAAGCAGG - Intergenic
1193663212 X:84282258-84282280 GTGTAATATTTCAGGGAAGCAGG + Intergenic
1193909953 X:87292096-87292118 ATGGAGATATTCAGGGAAGGAGG - Intergenic
1193974051 X:88095750-88095772 ATGTTCATGTTCAGGGAATGTGG + Intergenic
1194584710 X:95718136-95718158 ATTTACATTTTCAGGGAGAGGGG + Intergenic
1195034635 X:100961269-100961291 GGCTACTTTTGCAGGGAAGGAGG + Intergenic
1196098333 X:111823350-111823372 ATATCCATCTTCAGGGAAGGAGG - Intronic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1198955782 X:142128776-142128798 ATGTACATTTCCAGGCAAGGTGG + Intergenic