ID: 1089462221

View in Genome Browser
Species Human (GRCh38)
Location 11:118659979-118660001
Sequence GCACTGGCTGCTGGCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089462221_1089462228 7 Left 1089462221 11:118659979-118660001 CCTTTAGAGCCAGCAGCCAGTGC 0: 1
1: 0
2: 2
3: 20
4: 160
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1089462221_1089462224 -5 Left 1089462221 11:118659979-118660001 CCTTTAGAGCCAGCAGCCAGTGC 0: 1
1: 0
2: 2
3: 20
4: 160
Right 1089462224 11:118659997-118660019 AGTGCCCTGCCTGCTGCCCCAGG 0: 1
1: 0
2: 9
3: 45
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089462221 Original CRISPR GCACTGGCTGCTGGCTCTAA AGG (reversed) Intronic