ID: 1089462224

View in Genome Browser
Species Human (GRCh38)
Location 11:118659997-118660019
Sequence AGTGCCCTGCCTGCTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 9, 3: 45, 4: 479}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089462221_1089462224 -5 Left 1089462221 11:118659979-118660001 CCTTTAGAGCCAGCAGCCAGTGC 0: 1
1: 0
2: 2
3: 20
4: 160
Right 1089462224 11:118659997-118660019 AGTGCCCTGCCTGCTGCCCCAGG 0: 1
1: 0
2: 9
3: 45
4: 479
1089462218_1089462224 24 Left 1089462218 11:118659950-118659972 CCTGGGAGTCGTTCCCTGGGGCA 0: 2
1: 0
2: 1
3: 9
4: 123
Right 1089462224 11:118659997-118660019 AGTGCCCTGCCTGCTGCCCCAGG 0: 1
1: 0
2: 9
3: 45
4: 479
1089462219_1089462224 11 Left 1089462219 11:118659963-118659985 CCCTGGGGCAGTGCTGCCTTTAG 0: 1
1: 1
2: 2
3: 19
4: 202
Right 1089462224 11:118659997-118660019 AGTGCCCTGCCTGCTGCCCCAGG 0: 1
1: 0
2: 9
3: 45
4: 479
1089462220_1089462224 10 Left 1089462220 11:118659964-118659986 CCTGGGGCAGTGCTGCCTTTAGA 0: 1
1: 0
2: 3
3: 17
4: 203
Right 1089462224 11:118659997-118660019 AGTGCCCTGCCTGCTGCCCCAGG 0: 1
1: 0
2: 9
3: 45
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089462224 Original CRISPR AGTGCCCTGCCTGCTGCCCC AGG Intronic