ID: 1089462228

View in Genome Browser
Species Human (GRCh38)
Location 11:118660009-118660031
Sequence GCTGCCCCAGGCTTTTTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089462223_1089462228 -9 Left 1089462223 11:118659995-118660017 CCAGTGCCCTGCCTGCTGCCCCA 0: 1
1: 0
2: 10
3: 111
4: 1244
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1089462219_1089462228 23 Left 1089462219 11:118659963-118659985 CCCTGGGGCAGTGCTGCCTTTAG 0: 1
1: 1
2: 2
3: 19
4: 202
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1089462220_1089462228 22 Left 1089462220 11:118659964-118659986 CCTGGGGCAGTGCTGCCTTTAGA 0: 1
1: 0
2: 3
3: 17
4: 203
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1089462222_1089462228 -2 Left 1089462222 11:118659988-118660010 CCAGCAGCCAGTGCCCTGCCTGC 0: 1
1: 0
2: 7
3: 69
4: 570
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107
1089462221_1089462228 7 Left 1089462221 11:118659979-118660001 CCTTTAGAGCCAGCAGCCAGTGC 0: 1
1: 0
2: 2
3: 20
4: 160
Right 1089462228 11:118660009-118660031 GCTGCCCCAGGCTTTTTTCGTGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089462228 Original CRISPR GCTGCCCCAGGCTTTTTTCG TGG Intronic