ID: 1089463020

View in Genome Browser
Species Human (GRCh38)
Location 11:118663797-118663819
Sequence GCTTATGGCAGAAACCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089463013_1089463020 1 Left 1089463013 11:118663773-118663795 CCCTGTGTAGACTCGATCGGAAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 336
1089463011_1089463020 20 Left 1089463011 11:118663754-118663776 CCAATTCTCTGTACAATGGCCCT 0: 1
1: 0
2: 4
3: 9
4: 136
Right 1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 336
1089463014_1089463020 0 Left 1089463014 11:118663774-118663796 CCTGTGTAGACTCGATCGGAAGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089463020 Original CRISPR GCTTATGGCAGAAACCTGGG AGG Intronic
900507032 1:3034885-3034907 GCCTGGGGCAGACACCTGGGTGG - Intergenic
900604612 1:3518393-3518415 ACATTTGGCAGAATCCTGGGTGG - Intronic
900836174 1:5006009-5006031 GCTGATGGCAGATAGCTGGCAGG - Intergenic
901834911 1:11917844-11917866 GCGAATGGCATGAACCTGGGAGG + Intergenic
902239714 1:15080434-15080456 GCTGATGGCAGGACCCTTGGTGG - Intronic
903094773 1:20960493-20960515 GCTCATAGCAGAAATCTGGGAGG + Intronic
903487422 1:23701005-23701027 TTTTATGGCATGAACCTGGGAGG - Intergenic
903507204 1:23845979-23846001 GAATATGGGAGAAACCTGGCAGG + Intronic
903516999 1:23917946-23917968 GAGAATGGCAGGAACCTGGGAGG + Intergenic
904279359 1:29408058-29408080 GAGAATGGCATAAACCTGGGCGG - Intergenic
904794671 1:33050578-33050600 GCTTATGTCAAAACCCTGGCAGG + Intronic
905893840 1:41532885-41532907 GCCGACGGCAGAGACCTGGGTGG + Intronic
906236903 1:44217488-44217510 GCTCAAGCCAGAAACCTGGGAGG - Intronic
906321258 1:44818348-44818370 GCTGATGGCTGTAAACTGGGGGG + Intergenic
906586795 1:46985236-46985258 GAGAATGGCATAAACCTGGGAGG + Intergenic
909806737 1:79881844-79881866 GATTATAGCATGAACCTGGGAGG + Intergenic
910149889 1:84130098-84130120 GCTGATGGCATGAACCTGGGAGG + Intronic
912050049 1:105518364-105518386 GAGAATGGCAGGAACCTGGGAGG - Intergenic
914379168 1:147100877-147100899 GATAATGGCATGAACCTGGGAGG + Intergenic
915114901 1:153591223-153591245 GAGAATGGCATAAACCTGGGAGG + Intergenic
917949732 1:180018747-180018769 GCAGATGACAGAAAGCTGGGAGG - Intronic
918020345 1:180681554-180681576 GAGAATGGCATAAACCTGGGAGG + Intronic
919467959 1:197945046-197945068 GTAGATGGCAGAAAACTGGGAGG + Intergenic
919703853 1:200657657-200657679 GAGAATGGCACAAACCTGGGAGG + Intronic
920717213 1:208351520-208351542 GAGAATGGCATAAACCTGGGAGG - Intergenic
921507545 1:215990849-215990871 GAGAATGGCATAAACCTGGGAGG - Intronic
922457209 1:225784750-225784772 GAGAATGGCATAAACCTGGGAGG + Intronic
1062882851 10:992308-992330 GATAATGGCATGAACCTGGGAGG + Intronic
1063071556 10:2671557-2671579 TCTTGTGGCAGAAAACTAGGTGG - Intergenic
1064029296 10:11873644-11873666 GCTCATGCCAGAAATTTGGGAGG + Intergenic
1064220844 10:13439378-13439400 ACAGATGGCAGAACCCTGGGAGG - Exonic
1064446894 10:15403034-15403056 GAGTATGGCATGAACCTGGGAGG - Intergenic
1064649662 10:17496169-17496191 GAGAATTGCAGAAACCTGGGAGG + Intergenic
1064921102 10:20519271-20519293 GCTTTTTGCAGGAACCTGGATGG - Intergenic
1065297920 10:24294096-24294118 GCGAATGGCATGAACCTGGGAGG + Intronic
1067088411 10:43254618-43254640 GCTGCTGGCAGAAGGCTGGGTGG + Intronic
1068878578 10:62024426-62024448 GCTTATTTCAGAAACCAGAGTGG + Intronic
1069565765 10:69462422-69462444 GAGAATGGCATAAACCTGGGAGG - Intronic
1069746438 10:70717730-70717752 GCTTCTGGCTGCAACCTGGCTGG - Intronic
1070338987 10:75479415-75479437 GATAATGGCATGAACCTGGGAGG + Intronic
1071977858 10:90973301-90973323 GCATATGGTAAAAACCTGGAGGG + Intergenic
1072393368 10:95012976-95012998 GCTTTTTGCAGCAACCTGGAAGG - Intergenic
1073272924 10:102282014-102282036 GAGAATGGCAGGAACCTGGGAGG - Intronic
1075744785 10:124719330-124719352 ACTTAGGGCAAAGACCTGGGTGG + Intronic
1076396271 10:130139550-130139572 GCGAATGGCATGAACCTGGGAGG + Intronic
1077086682 11:755980-756002 GCCTATGGCCGGAAGCTGGGCGG + Exonic
1077962073 11:7086373-7086395 GCTTGTGGCAAAAGCCTGGAGGG - Intergenic
1078413940 11:11149988-11150010 GCATATGCAAGGAACCTGGGTGG - Intergenic
1078576687 11:12508815-12508837 GCTTAAGGTACAAACTTGGGTGG + Intronic
1078818451 11:14850916-14850938 GATAATGGCATGAACCTGGGGGG - Intronic
1080493661 11:32794952-32794974 GAGAATGGCATAAACCTGGGAGG - Intergenic
1082056674 11:47823622-47823644 GAGAATGGCAGGAACCTGGGAGG - Intronic
1084989212 11:72907678-72907700 GAGTATGGCATGAACCTGGGAGG - Intronic
1085278529 11:75315239-75315261 GCATAAGGCAGATACCTGGATGG - Intronic
1085782834 11:79424842-79424864 GAGAATGGCATAAACCTGGGAGG + Intronic
1086507716 11:87523118-87523140 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1087084775 11:94205620-94205642 GCTTTTGGCAGAAACCTTACAGG + Intergenic
1087154726 11:94889752-94889774 GAGAATGGCATAAACCTGGGAGG + Intergenic
1089319076 11:117612847-117612869 GCTGATGGAAGACACCTGGGTGG + Intronic
1089411282 11:118244984-118245006 GATAATGGCATGAACCTGGGAGG + Intronic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1089685200 11:120142187-120142209 CCTCATGGGAGAAGCCTGGGAGG - Intronic
1090113352 11:123940045-123940067 CCTTATGGCAGCCTCCTGGGTGG + Exonic
1091870769 12:3889200-3889222 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1092675441 12:10913363-10913385 GAGAATGGCAGGAACCTGGGAGG + Intronic
1096835189 12:54345865-54345887 GCGAATGGCATGAACCTGGGAGG + Intronic
1098419978 12:70285297-70285319 GAGAATGGCATAAACCTGGGAGG - Intronic
1102093800 12:110218954-110218976 GAGTATGGCATGAACCTGGGAGG - Intergenic
1103208230 12:119146844-119146866 GAGAATGGCATAAACCTGGGAGG + Intronic
1103907386 12:124334698-124334720 GCTCGGGGCAGAATCCTGGGTGG + Intronic
1103998744 12:124846839-124846861 GCTTATCGCAGCAATGTGGGTGG + Intronic
1105686415 13:22786770-22786792 GAGAATGGCATAAACCTGGGAGG - Intergenic
1105723770 13:23141309-23141331 GAGAATGGCATAAACCTGGGAGG + Intergenic
1106792212 13:33167268-33167290 GCTGATGGCAGAATGCTGGAAGG + Intronic
1106838808 13:33664714-33664736 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1107061805 13:36167272-36167294 GCTGAAGCCAGAAGCCTGGGTGG + Intergenic
1107896141 13:44965602-44965624 GAGAATGGCACAAACCTGGGAGG + Intronic
1109219240 13:59624773-59624795 GCTAATGGTAGTAAACTGGGGGG + Intergenic
1110060778 13:71034824-71034846 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1110498945 13:76203067-76203089 GAGAATGGCATAAACCTGGGAGG + Intergenic
1111459453 13:88520187-88520209 ACTAATGGCATGAACCTGGGAGG + Intergenic
1112978370 13:105349395-105349417 GTTTTTGCCAGAAAACTGGGAGG - Intergenic
1115251148 14:31349292-31349314 GCTGATGGCGTGAACCTGGGAGG + Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1117925483 14:60774774-60774796 GCTAATGCCAAAAACCTAGGAGG - Intronic
1118298374 14:64591431-64591453 GAGAATGGCATAAACCTGGGAGG - Intergenic
1118424433 14:65644378-65644400 GATAATGGCATGAACCTGGGAGG - Intronic
1119050874 14:71367394-71367416 GAGAATGGCAGAAACCCGGGAGG - Intronic
1119245835 14:73106920-73106942 GCTTATCGCTTGAACCTGGGAGG - Intronic
1119493181 14:75055174-75055196 GAGAATGGCATAAACCTGGGAGG - Intronic
1120228937 14:81821970-81821992 GCTTTAGGCAGAAAACAGGGAGG + Intergenic
1120364045 14:83542166-83542188 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1121448012 14:93990456-93990478 GCTTCTGCCAGATCCCTGGGTGG - Intergenic
1121707268 14:96007162-96007184 GATAATGGCATGAACCTGGGAGG + Intergenic
1122459019 14:101879872-101879894 GCTAATGACAGGACCCTGGGAGG + Intronic
1122580334 14:102767776-102767798 GCCTCTGGCAGAGAACTGGGTGG + Intergenic
1123772274 15:23540484-23540506 GATTGTGGCAGAAAGCTGGAGGG - Intergenic
1124787460 15:32695103-32695125 GAGAATGGCAGGAACCTGGGAGG - Intronic
1127497859 15:59529492-59529514 GAGAATGGCTGAAACCTGGGAGG - Intergenic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1128797957 15:70478703-70478725 GCTTCTGGCTGAGCCCTGGGTGG + Intergenic
1129023551 15:72547015-72547037 GCGAATGGCATGAACCTGGGAGG - Intronic
1129556819 15:76518622-76518644 GCTTATGGGAGAAACACAGGAGG + Intronic
1129703547 15:77781873-77781895 GCAGATGGGAGGAACCTGGGAGG - Intronic
1131709810 15:95040759-95040781 GAGAATGGCATAAACCTGGGAGG + Intergenic
1132028111 15:98419991-98420013 TCTTAAGGCAGTAAACTGGGGGG + Intergenic
1132795259 16:1717939-1717961 GAGAATGGCAGGAACCTGGGAGG - Intronic
1133571692 16:7046970-7046992 GCTTAAAGCAAAAAACTGGGGGG - Intronic
1134403109 16:13929872-13929894 GATAATGGCACGAACCTGGGAGG + Intronic
1135000876 16:18775741-18775763 GCTTAAAGCTGAAAACTGGGTGG - Intergenic
1138262117 16:55631368-55631390 ACTGATGGCAGTTACCTGGGAGG - Intergenic
1138384582 16:56627466-56627488 GATAATGGCATGAACCTGGGAGG + Intergenic
1139178398 16:64716540-64716562 GCTTATTACAGAAACCTAGGTGG - Intergenic
1139523053 16:67496257-67496279 GCCTAAGGTAGGAACCTGGGAGG + Intergenic
1139795001 16:69475806-69475828 GAGAATGGCAGAAACCCGGGAGG - Intergenic
1139913068 16:70410338-70410360 GAGAATGGCATAAACCTGGGAGG - Intronic
1141460120 16:84173372-84173394 GAGAATGGCAGGAACCTGGGAGG + Intronic
1141964046 16:87429523-87429545 GCTCATGCCAGCAACCTAGGCGG + Intronic
1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG + Intronic
1142668464 17:1475786-1475808 GATTCCAGCAGAAACCTGGGAGG + Intronic
1142702002 17:1668449-1668471 GAGAATGGCAGGAACCTGGGAGG - Intronic
1143171684 17:4933992-4934014 GCTTGTGGCAGACACCAGGATGG - Exonic
1143716548 17:8775513-8775535 GCTCATGGCAGAAAGCCAGGGGG - Intergenic
1144923567 17:18784053-18784075 GAGAATGGCATAAACCTGGGAGG + Intronic
1145873490 17:28296650-28296672 GCTTACTCCAGAAACATGGGTGG - Intergenic
1146232397 17:31124687-31124709 GAGAATGGCATAAACCTGGGAGG - Intronic
1146282801 17:31556022-31556044 GCCTGAGGCAGGAACCTGGGAGG + Intergenic
1147491077 17:40866915-40866937 GGTTATGGGAGAGCCCTGGGTGG - Exonic
1148009472 17:44464506-44464528 GCTTACTCCAGAAACATGGGTGG - Exonic
1149750290 17:59139305-59139327 GAGAATGGCATAAACCTGGGAGG + Intronic
1150339858 17:64357647-64357669 GCTTAGGGCAGACAGCTGGTGGG - Intronic
1150396095 17:64823119-64823141 GCATGTGGCAGAAAAGTGGGTGG + Intergenic
1150859898 17:68790573-68790595 GCTAATGGCAGAAACTGGGCTGG + Intergenic
1151997496 17:77619157-77619179 GCAAATGGCACACACCTGGGAGG - Intergenic
1152385079 17:79968761-79968783 GAGAATGGCAGGAACCTGGGAGG + Intronic
1154219222 18:12437471-12437493 GATAATGGCATAAACCTGGCAGG - Intergenic
1154488234 18:14896219-14896241 GGAAATGGCACAAACCTGGGAGG - Intergenic
1155363221 18:25024532-25024554 GAGAATGGCATAAACCTGGGAGG + Intergenic
1157562663 18:48659718-48659740 GCTTGGGGCAGAGACCTGTGGGG + Intronic
1159067850 18:63589555-63589577 GCTTCTGAAAGAAACCTCGGTGG - Intronic
1159971654 18:74663381-74663403 TTTAATGACAGAAACCTGGGAGG + Intronic
1161091692 19:2363463-2363485 TCTGATGGCAGACACATGGGTGG + Intergenic
1161449976 19:4339899-4339921 GCGAATGGCATGAACCTGGGAGG - Intronic
1162476148 19:10900771-10900793 GAGAATGGCAGGAACCTGGGAGG - Intronic
1162488061 19:10973974-10973996 GGTTATGGCAGAGGCTTGGGCGG - Intronic
1162827388 19:13261753-13261775 GCTTATTTCTGAAAGCTGGGGGG - Intronic
1162967927 19:14164661-14164683 GCTGATGTCAGAAAGGTGGGGGG + Intronic
1162996761 19:14340731-14340753 GAGAATGGCACAAACCTGGGAGG + Intergenic
1163365194 19:16872110-16872132 GATTCTGGCAGAAACCAGGCAGG - Intronic
1165548536 19:36562745-36562767 GAGAATGGCAGGAACCTGGGAGG + Intronic
1165797228 19:38526303-38526325 TCTTGGGGCAGAATCCTGGGAGG - Intronic
1167364183 19:49046353-49046375 GAGAATGGCAGGAACCTGGGAGG - Intergenic
925262823 2:2542969-2542991 TCTCATCGCAGACACCTGGGAGG - Intergenic
925747850 2:7059255-7059277 GAGTATGGCATGAACCTGGGAGG + Intronic
926805097 2:16701070-16701092 GATTATTGCAGCAATCTGGGTGG + Intergenic
926935840 2:18086087-18086109 GAGAATGGCAGGAACCTGGGAGG - Intronic
928262337 2:29779064-29779086 GAGAATGGCAGGAACCTGGGAGG + Intronic
929331780 2:40691081-40691103 GCTTATGGAAATCACCTGGGAGG + Intergenic
929665883 2:43833470-43833492 GATAATGGCATGAACCTGGGAGG - Intronic
932408338 2:71528984-71529006 GGTGATGGCTGAAGCCTGGGAGG - Intronic
932863754 2:75320593-75320615 GAGAATGGCATAAACCTGGGAGG - Intergenic
933529732 2:83491907-83491929 GACAATGGCAGGAACCTGGGAGG + Intergenic
934134634 2:88983877-88983899 GAGAATGGCTGAAACCTGGGAGG - Intergenic
935683860 2:105666255-105666277 ACTGAAGGAAGAAACCTGGGAGG - Intergenic
935715078 2:105932391-105932413 GAGAATGGCATAAACCTGGGAGG - Intergenic
937294627 2:120802373-120802395 GCAGACGGCAGAAGCCTGGGAGG + Intronic
938245162 2:129770760-129770782 GAGAATGGCAGGAACCTGGGAGG + Intergenic
938380531 2:130833962-130833984 GAGAATGGCAGGAACCTGGGAGG + Intergenic
938556271 2:132427252-132427274 GAGTATGGCATGAACCTGGGAGG - Intronic
938617233 2:133012335-133012357 GATAATGGCGGGAACCTGGGAGG - Intronic
938904784 2:135827411-135827433 GCTTATCCCAGACACCTGGGAGG - Intronic
939057334 2:137381206-137381228 GGCTCTGGTAGAAACCTGGGTGG + Intronic
940220074 2:151342580-151342602 GAGAATGGCAGGAACCTGGGAGG + Intergenic
941766588 2:169304022-169304044 CCTTCTGGCAAAAACCTGGCAGG - Intronic
942204707 2:173608604-173608626 GCTTATGGCAGAGAAATAGGAGG + Intergenic
943093348 2:183399990-183400012 GAGTATGGCCGGAACCTGGGAGG - Intergenic
944572924 2:201062559-201062581 GAGTATGGCATGAACCTGGGAGG + Intronic
945182512 2:207106491-207106513 GCTCATAGCAAAACCCTGGGAGG - Intronic
946736585 2:222759820-222759842 GGGAATGGCACAAACCTGGGAGG + Intergenic
948495447 2:238345778-238345800 GGTGATGGCAGGAGCCTGGGTGG + Intronic
1169100900 20:2948113-2948135 GCTTATGGCATAATCTGGGGTGG + Intronic
1169223485 20:3841041-3841063 GAGAATGGCATAAACCTGGGAGG + Intergenic
1169387359 20:5162412-5162434 GCATAAGCCAGAAACCTGAGAGG - Intronic
1170227992 20:14013360-14013382 GAGTATGGCATGAACCTGGGAGG - Intronic
1172182098 20:33009795-33009817 GTTTTTGGCAGAAATCTGGCTGG + Intronic
1172269931 20:33649177-33649199 GCTGTTTGCAGAAAACTGGGTGG + Exonic
1172650586 20:36499083-36499105 CCCTGTGGCAGAAACCTGGAGGG - Intronic
1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG + Intergenic
1175329046 20:58150071-58150093 GGGTATGGTAGAAACCTAGGGGG + Intergenic
1177627068 21:23675380-23675402 GCCTTTTGCAGAAACCTGGATGG - Intergenic
1177940992 21:27411127-27411149 GATTATGGCACAAAGCTGGAGGG + Intergenic
1178229780 21:30768757-30768779 GCTTCTGGCAGAATGCTGGGAGG - Intergenic
1178990327 21:37349703-37349725 GTGAATGGCACAAACCTGGGAGG - Intergenic
1179182711 21:39059258-39059280 GGTGATGGCAGAAACTTGCGGGG - Intergenic
1180626686 22:17198655-17198677 GCTTATGGGAGACACGTCGGTGG - Intronic
1180781900 22:18525247-18525269 GATAATGGCATAAACCCGGGAGG - Intergenic
1181153691 22:20903638-20903660 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1181238786 22:21464591-21464613 GATAATGGCATAAACCCGGGAGG - Intergenic
1183066996 22:35370225-35370247 GCTGATGGCAGTTACCTAGGAGG - Intergenic
1183094300 22:35542851-35542873 GGTTAGGGGAGAATCCTGGGAGG + Intronic
1183419601 22:37703592-37703614 GAGAATGGCATAAACCTGGGAGG - Intronic
1183450098 22:37889137-37889159 GAGAATGGCAGGAACCTGGGAGG - Exonic
1184088976 22:42282676-42282698 GCTGGGGGCAGAGACCTGGGAGG + Intronic
1184270913 22:43382832-43382854 GAGAATGGCATAAACCTGGGAGG + Intergenic
1184767859 22:46581057-46581079 GCATGTGGCAGAGGCCTGGGCGG + Intronic
950070179 3:10145614-10145636 GAGAATGGCATAAACCTGGGAGG + Intronic
950747362 3:15101165-15101187 GAGAATGGCATAAACCTGGGAGG - Intergenic
950824555 3:15803713-15803735 GCTTAAGTCAAAAACCTGGGAGG - Intronic
950972289 3:17201434-17201456 ACTTGGGGCAGAAAGCTGGGAGG + Intronic
951471969 3:23066154-23066176 GAGAATGGCACAAACCTGGGAGG - Intergenic
952250718 3:31650467-31650489 GAGTATGGCAAGAACCTGGGAGG + Intergenic
953798337 3:46002376-46002398 GCTGATGGCAGTTACCTGCGAGG - Intergenic
953817122 3:46168206-46168228 GAGAATGGCAGGAACCTGGGAGG - Intronic
956616637 3:71178792-71178814 GAGAATGGCAGGAACCTGGGAGG + Intronic
958257703 3:91344203-91344225 GATAATGGCATGAACCTGGGAGG - Intergenic
958725321 3:97898128-97898150 GAGAATGGCGGAAACCTGGGAGG + Intronic
961701263 3:128746616-128746638 GAGTATGGCATGAACCTGGGAGG - Intronic
962160044 3:132989426-132989448 GCGAATGGCATGAACCTGGGAGG + Intergenic
964185441 3:153937284-153937306 GAGAATGGCATAAACCTGGGAGG - Intergenic
964310819 3:155390108-155390130 ACTTTTGGCAGAAAGCTGGAAGG + Intronic
964645352 3:158952991-158953013 TCTAATGGCAGACACCAGGGTGG + Intergenic
966196380 3:177318177-177318199 GCGAATGGCATGAACCTGGGAGG - Intergenic
966621307 3:181967193-181967215 TCTTAAGTCAGAAACCTGGTAGG + Intergenic
966705316 3:182907001-182907023 GAGAATGGCATAAACCTGGGAGG + Intronic
967932161 3:194697969-194697991 TTTTTTGGCGGAAACCTGGGAGG - Intergenic
971135087 4:23859689-23859711 GACAATGGCAGGAACCTGGGAGG + Intronic
972559643 4:40215424-40215446 ACTTATGCCAGTTACCTGGGTGG + Intronic
975763444 4:77641121-77641143 TCTTATTCCAGAAACCTGAGAGG - Intergenic
976593156 4:86869481-86869503 GCTTAGGCCAGAAACCCAGGGGG - Intergenic
976609621 4:87016459-87016481 GAGAATGGCATAAACCTGGGAGG + Intronic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
981100745 4:140826581-140826603 GAGAATGGCATAAACCTGGGAGG - Intergenic
981136637 4:141218325-141218347 TCTTATGGTAGAAACCTAGAAGG + Intergenic
981725668 4:147844632-147844654 GTTCATGCCAGAAATCTGGGAGG + Intronic
982984387 4:162187568-162187590 GAGAATGGCATAAACCTGGGAGG - Intergenic
983317630 4:166151987-166152009 GAGAATGGCATAAACCTGGGAGG + Intergenic
983498877 4:168477323-168477345 GAGAATGGCATAAACCTGGGAGG + Intronic
986269899 5:6221134-6221156 GCTTAGGGCACAAAACAGGGAGG - Intergenic
986354953 5:6914628-6914650 TCTTATGGAAGGAAACTGGGTGG + Intergenic
986439566 5:7767939-7767961 GATAATGGCATGAACCTGGGAGG + Intronic
986470456 5:8068511-8068533 GAGTATGGTAGAAATCTGGGAGG + Intergenic
987077019 5:14392955-14392977 GAGAATGGCATAAACCTGGGAGG + Intronic
987166848 5:15207834-15207856 TCTTATGGCATGAACCCGGGAGG + Intergenic
987326956 5:16821554-16821576 GAGAATGGCATAAACCTGGGAGG - Intronic
987462160 5:18224561-18224583 GAGTATGGCATGAACCTGGGAGG - Intergenic
988622827 5:32841304-32841326 GCGAATGGCATGAACCTGGGAGG - Intergenic
988661635 5:33276567-33276589 TCATATGGTAGAAACCTTGGAGG + Intergenic
993706153 5:91172937-91172959 TCTTAAGGCAGAAACGTGGCTGG - Intergenic
993721244 5:91323860-91323882 GAGAATGGCAGGAACCTGGGAGG - Intergenic
994179055 5:96743846-96743868 GGTGTTGGCAGAATCCTGGGGGG + Intronic
994943106 5:106350296-106350318 GAGAATGGCATAAACCTGGGAGG - Intergenic
994981221 5:106876519-106876541 GGCTATGGTGGAAACCTGGGTGG - Intergenic
996080583 5:119254445-119254467 GAGAATGGCAGGAACCTGGGAGG + Intergenic
996224184 5:120970094-120970116 GAGAATGGCATAAACCTGGGAGG + Intergenic
997165621 5:131657949-131657971 GCGAATGGCATGAACCTGGGAGG + Intronic
997265898 5:132495377-132495399 GATTTTCACAGAAACCTGGGAGG + Intergenic
997388385 5:133493534-133493556 ACTTAAGGCTGAGACCTGGGAGG - Intronic
997982719 5:138479096-138479118 GATAATGGCATGAACCTGGGAGG + Intergenic
998383139 5:141740135-141740157 GAGTATGGCATGAACCTGGGAGG + Intergenic
998853941 5:146376893-146376915 GCTTCTGGCTGAACCCTTGGAGG + Intergenic
999536111 5:152519155-152519177 GCTTAGGCCAGTACCCTGGGGGG + Intergenic
999795118 5:154981911-154981933 GCTGATGCCAGAAACCAGGTAGG + Intergenic
1001613956 5:173027087-173027109 GATAATGGCATGAACCTGGGAGG + Intronic
1002807049 6:587332-587354 GAGAATGGCAGGAACCTGGGAGG - Intronic
1003626808 6:7748533-7748555 GCTTATGAGAGAAACCTACGAGG + Intronic
1005697847 6:28367807-28367829 GAGAATGGCAGGAACCTGGGAGG - Exonic
1006234708 6:32618690-32618712 GATAATGGCATGAACCTGGGAGG + Intergenic
1006605382 6:35252589-35252611 GCTTAAGAAAGAAACCTGGAGGG - Exonic
1008378167 6:50814645-50814667 GCTTAAGACAGAAACATGGTAGG + Intergenic
1011561139 6:88617178-88617200 GATAATGGCATGAACCTGGGAGG + Intronic
1011631192 6:89326305-89326327 GATTATGCCAGACACCTAGGTGG + Intergenic
1012039231 6:94184091-94184113 GATAATGGCATGAACCTGGGAGG - Intergenic
1013064324 6:106669136-106669158 GATAATGGCATGAACCTGGGAGG + Intergenic
1013089287 6:106885006-106885028 GCTTATGACAGAAATCGTGGGGG - Intergenic
1013106963 6:107033726-107033748 GAGAATGGCAGGAACCTGGGAGG + Intronic
1014725973 6:124972161-124972183 ACTCAGGTCAGAAACCTGGGGGG + Intronic
1015387842 6:132646115-132646137 ACTTATCCCAGAAACCTAGGAGG + Intergenic
1016347416 6:143129199-143129221 GCGAATGGCATGAACCTGGGAGG + Intronic
1017436617 6:154421575-154421597 TCTTATTGCCGACACCTGGGTGG - Intronic
1017443975 6:154490764-154490786 GTTCTTGGCAGAAAACTGGGAGG - Intronic
1017689033 6:156945010-156945032 GAGAATGGCAGGAACCTGGGAGG - Intronic
1017910861 6:158791796-158791818 GAGAATGGCAGGAACCTGGGAGG - Intronic
1018006724 6:159629235-159629257 GATAATGGCATAAACCCGGGAGG + Intergenic
1018091700 6:160351203-160351225 GAGAATGGCAGGAACCTGGGAGG - Intronic
1018366825 6:163129600-163129622 GCTTACCTCAAAAACCTGGGCGG - Intronic
1018861500 6:167713453-167713475 GCTGGTGGAAGACACCTGGGAGG + Intergenic
1019129880 6:169865797-169865819 GCCATTGGCAGAATCCTGGGAGG + Intergenic
1019529889 7:1498129-1498151 TCTTAGCTCAGAAACCTGGGTGG + Intronic
1022986322 7:35657830-35657852 GTGAATGGCAGGAACCTGGGAGG + Intronic
1023005440 7:35860683-35860705 CTTTTTGGCAGAAACCTTGGAGG - Intronic
1023825913 7:44008718-44008740 GCTAATGGCAGACACCAGGAAGG + Exonic
1024632852 7:51263400-51263422 GCTTTTGGCAGCAATATGGGGGG + Intronic
1024905549 7:54374905-54374927 GCTTTAGACAGAAACGTGGGTGG - Intergenic
1025826981 7:65018582-65018604 GAGAATGGCATAAACCTGGGAGG + Intergenic
1026089483 7:67287569-67287591 GCTAATGGCAGACACCAGGAAGG + Intergenic
1026925403 7:74188851-74188873 ACTTAGGGAGGAAACCTGGGGGG + Intronic
1027119078 7:75502884-75502906 GCTAATGGCAGACACCAGGAAGG + Intergenic
1028261282 7:88669462-88669484 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1028955955 7:96690858-96690880 GACAATGGCATAAACCTGGGAGG - Intronic
1029718420 7:102347148-102347170 GCTAATGGCAGACACCAGGCAGG - Intergenic
1029754196 7:102562107-102562129 GCTAATGGCAGACACCAGGCAGG + Intronic
1029772146 7:102661197-102661219 GCTAATGGCAGACACCAGGCAGG + Intronic
1031174311 7:118330221-118330243 CCTTATGGTAAAAATCTGGGTGG + Intergenic
1031908587 7:127489203-127489225 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1032496924 7:132369498-132369520 GCTAATGGAAGAAGCCAGGGGGG + Intronic
1032590602 7:133188748-133188770 GAGAATGGCATAAACCTGGGAGG - Intergenic
1033884843 7:145932651-145932673 GGATATGTCAGAAACCTGTGTGG + Intergenic
1034161124 7:148994946-148994968 GCCTATGGCAGCACCCTGGGGGG - Intergenic
1035996690 8:4555229-4555251 GGTTATTGCAGAAATCTGAGAGG + Intronic
1037032622 8:14127543-14127565 GCTAATGGCATGAACCCGGGAGG - Intronic
1038580879 8:28748279-28748301 GAGAATGGCATAAACCTGGGAGG + Intronic
1039381745 8:37092163-37092185 GCTAATGGCGTGAACCTGGGAGG - Intergenic
1039987025 8:42456353-42456375 TCTTAAGTCAGCAACCTGGGAGG + Intronic
1040409398 8:47139121-47139143 GAGAATGGCAGGAACCTGGGAGG - Intergenic
1041540406 8:58978347-58978369 GCATAAGGCAGACATCTGGGAGG + Intronic
1043464568 8:80492020-80492042 GTTTATGGCAGAAATAAGGGCGG + Intronic
1043617907 8:82150230-82150252 GAGAATGGCACAAACCTGGGAGG - Intergenic
1045153430 8:99436826-99436848 GAGAATGGCATAAACCTGGGAGG - Intronic
1045834639 8:106506106-106506128 GCTCATGACAGAAACCTTGAAGG - Intronic
1045869459 8:106908485-106908507 GAGAATGGCATAAACCTGGGAGG - Intergenic
1045903470 8:107313527-107313549 GAGAATGGCAGAAACCTGGGAGG - Intronic
1046624967 8:116567015-116567037 GTTTATAGAAGAAACCTGGATGG + Intergenic
1048453363 8:134554101-134554123 GCTTATGTGAGTAATCTGGGTGG - Intronic
1050429073 9:5543447-5543469 GAGAATGGCAGGAACCTGGGAGG + Intronic
1053507388 9:38654917-38654939 GAGAATGGCATAAACCTGGGAGG - Intergenic
1055168303 9:73223595-73223617 GCTTAGGGCAAGAAACTGGGAGG - Intergenic
1056736456 9:89214110-89214132 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1057997860 9:99836132-99836154 GCAAATGACAGAAAGCTGGGAGG + Intronic
1060500574 9:124150773-124150795 GATAATGGCAGACACCTGGGAGG - Intergenic
1060662777 9:125414143-125414165 GTATAAGCCAGAAACCTGGGAGG - Intergenic
1061646193 9:132004042-132004064 GCCTGTGGCAGAAAGCTAGGAGG - Intronic
1062509750 9:136898306-136898328 GCTTATTGCAGGAACCATGGGGG + Intronic
1186114416 X:6290273-6290295 TCTTTTGGCAGCAACATGGGTGG + Intergenic
1186691600 X:11983405-11983427 GCTTTTAGCAGAATCCTGAGAGG + Intergenic
1186785952 X:12956041-12956063 GCTAATGGCAGTCACCTCGGTGG + Intergenic
1187609802 X:20929819-20929841 GCTTGTGAGAGAAAACTGGGAGG + Intergenic
1188174085 X:26966494-26966516 GATGATGGCATAAACCTGTGTGG + Intergenic
1188491048 X:30739353-30739375 GATAATTGCTGAAACCTGGGAGG - Intergenic
1188660672 X:32754003-32754025 GCAGATGGCACAAATCTGGGTGG - Intronic
1188956716 X:36442301-36442323 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1189326210 X:40112912-40112934 GCTTAAAGCAGAATCCTAGGGGG + Intronic
1192468154 X:71372954-71372976 GATAATGGCGTAAACCTGGGAGG - Intronic
1198465909 X:136904673-136904695 GCTGATGGCGTGAACCTGGGAGG + Intergenic
1199424459 X:147684599-147684621 GAGAATGGCATAAACCTGGGAGG + Intergenic
1199535139 X:148894285-148894307 GCAGATGGCAGATATCTGGGGGG - Intronic
1200814180 Y:7514525-7514547 GAGAATGGCAGGAACCTGGGAGG + Intergenic
1201552580 Y:15234350-15234372 GAGTATGGCATGAACCTGGGAGG - Intergenic
1201559715 Y:15302939-15302961 GAGAATGGCAGGAACCTGGGAGG + Intergenic