ID: 1089466614

View in Genome Browser
Species Human (GRCh38)
Location 11:118689994-118690016
Sequence CGGGGACGCCCTGGGGGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089466595_1089466614 14 Left 1089466595 11:118689957-118689979 CCTGAGCCCTGCCAAGCCTGACC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466603_1089466614 -7 Left 1089466603 11:118689978-118690000 CCCTCCCGCCTCACCACGGGGAC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466599_1089466614 -2 Left 1089466599 11:118689973-118689995 CCTGACCCTCCCGCCTCACCACG No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466598_1089466614 3 Left 1089466598 11:118689968-118689990 CCAAGCCTGACCCTCCCGCCTCA No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466596_1089466614 8 Left 1089466596 11:118689963-118689985 CCCTGCCAAGCCTGACCCTCCCG No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466593_1089466614 28 Left 1089466593 11:118689943-118689965 CCAGCTGCGCTTGCCCTGAGCCC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466597_1089466614 7 Left 1089466597 11:118689964-118689986 CCTGCCAAGCCTGACCCTCCCGC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466604_1089466614 -8 Left 1089466604 11:118689979-118690001 CCTCCCGCCTCACCACGGGGACG No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466594_1089466614 15 Left 1089466594 11:118689956-118689978 CCCTGAGCCCTGCCAAGCCTGAC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data
1089466592_1089466614 29 Left 1089466592 11:118689942-118689964 CCCAGCTGCGCTTGCCCTGAGCC No data
Right 1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089466614 Original CRISPR CGGGGACGCCCTGGGGGTAC GGG Intergenic
No off target data available for this crispr