ID: 1089467209

View in Genome Browser
Species Human (GRCh38)
Location 11:118693003-118693025
Sequence TTCCCAAGAGACCCCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089467204_1089467209 17 Left 1089467204 11:118692963-118692985 CCAGGGATTCGCAGTGTTAGTTG No data
Right 1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG No data
1089467208_1089467209 -10 Left 1089467208 11:118692990-118693012 CCGGGGACACTAGTTCCCAAGAG No data
Right 1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG No data
1089467203_1089467209 18 Left 1089467203 11:118692962-118692984 CCCAGGGATTCGCAGTGTTAGTT No data
Right 1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089467209 Original CRISPR TTCCCAAGAGACCCCACTGA AGG Intergenic
No off target data available for this crispr