ID: 1089471947

View in Genome Browser
Species Human (GRCh38)
Location 11:118728430-118728452
Sequence ATTGATAAGCTACTGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089471940_1089471947 29 Left 1089471940 11:118728378-118728400 CCATACTGACTTTCTGGGGGTGG 0: 23
1: 6
2: 5
3: 9
4: 147
Right 1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089471947 Original CRISPR ATTGATAAGCTACTGGTGGT TGG Intergenic
No off target data available for this crispr