ID: 1089474822

View in Genome Browser
Species Human (GRCh38)
Location 11:118750811-118750833
Sequence TAGGTTTACCAGAGAGAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089474822_1089474826 6 Left 1089474822 11:118750811-118750833 CCTTGCTCTCTCTGGTAAACCTA 0: 1
1: 1
2: 0
3: 13
4: 178
Right 1089474826 11:118750840-118750862 AGGTACTAGATGAGACAGTGTGG 0: 2
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089474822 Original CRISPR TAGGTTTACCAGAGAGAGCA AGG (reversed) Exonic
901358109 1:8670152-8670174 TCAGGTTAACAGAGAGAGCAGGG - Intronic
902184712 1:14716710-14716732 TAGGTTAACTAGGGACAGCAGGG - Intronic
902652570 1:17846120-17846142 GAGGTTTACAGGAGAGGGCAGGG - Intergenic
905520245 1:38593505-38593527 TAGAGTCATCAGAGAGAGCATGG - Intergenic
905906290 1:41620693-41620715 AAGGTTTACCAGAGACAGAGGGG - Intronic
906225827 1:44120349-44120371 AAGCTTGCCCAGAGAGAGCAGGG + Intronic
906360768 1:45156276-45156298 GGGGATTACCAGAGAGAGAAAGG + Intronic
907769143 1:57442671-57442693 TATGTTTTCCGGAGAGAGAAAGG + Intronic
909456476 1:75855456-75855478 CAGGTTTCGCAGAGAGAGCATGG - Intronic
911017969 1:93355345-93355367 TAGGCTTACAAGAGTGAACAAGG + Intronic
912816987 1:112837395-112837417 TAGTATGCCCAGAGAGAGCACGG - Intergenic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
918630353 1:186710022-186710044 TTGGATTTCCAGAGATAGCAAGG - Intergenic
919465354 1:197918034-197918056 TTGGTTTAACAGAGGGCGCAGGG - Intronic
919973797 1:202597959-202597981 GAGGCTTCCCAGAGAGAGCTTGG - Intronic
921555277 1:216591341-216591363 GTGGTGTGCCAGAGAGAGCATGG + Intronic
924081183 1:240400113-240400135 GAAGTTTAACAGAGAGATCAAGG + Intronic
1063954574 10:11254668-11254690 TAGGTTTAGCAGTGAAACCAAGG + Intronic
1064222641 10:13455219-13455241 AACGTTCACCAGAGAGAACATGG + Intronic
1065308541 10:24391842-24391864 TGGGTATAGCAGAGAGAGAATGG - Intronic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066692606 10:38045675-38045697 AAAGTTTACTGGAGAGAGCAAGG - Intronic
1067000167 10:42603426-42603448 AAAGTTTACTGGAGAGAGCAAGG + Intronic
1067480243 10:46591029-46591051 TAGATTTATTAGAGGGAGCATGG + Intronic
1067614494 10:47750771-47750793 TAGATTTATTAGAGGGAGCATGG - Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1070943764 10:80371355-80371377 TCAGTTTACCTGGGAGAGCAGGG - Intergenic
1071629899 10:87210742-87210764 TAGATTTATTAGAGGGAGCATGG - Intergenic
1071761197 10:88609296-88609318 AAGGTTTACCAAAGAAAACAAGG - Intergenic
1072263318 10:93702878-93702900 TAAGGTTACTAGAGAGAGGACGG - Intergenic
1073134102 10:101210360-101210382 TAGGTCTAATAGAAAGAGCAGGG - Intergenic
1073150295 10:101306866-101306888 GAAGTGTACCAGAAAGAGCATGG + Intergenic
1074366361 10:112860626-112860648 TAGCCATACCAGAGAGAACAGGG - Intergenic
1079673068 11:23191572-23191594 TAGGTTTAAGAGAGATTGCAGGG - Intergenic
1083448739 11:62728187-62728209 TCGGTTTACCAGCAGGAGCAAGG - Intronic
1084512754 11:69616382-69616404 TGGGTTTACCAGAGGCAGGAAGG - Intergenic
1086585686 11:88448768-88448790 TAGGTTTTCAAGGGAAAGCAAGG - Intergenic
1089474822 11:118750811-118750833 TAGGTTTACCAGAGAGAGCAAGG - Exonic
1091160708 11:133417042-133417064 TAAGGTGCCCAGAGAGAGCAGGG + Intronic
1091359956 11:134971306-134971328 GAGGTTTAACAGAGAGAGAATGG - Intergenic
1094415049 12:30207372-30207394 TTGACTTACCAGAGAGAGCTAGG + Intergenic
1099893570 12:88618135-88618157 TAGGTTTTCTAGAGTGAGTAGGG + Intergenic
1100125522 12:91420138-91420160 TAATTTTAGGAGAGAGAGCAGGG - Intergenic
1102584851 12:113915584-113915606 GAGGTTTCCCTGGGAGAGCAGGG - Intronic
1106133357 13:26957447-26957469 TAGGTGAGCCAGAGAAAGCATGG + Intergenic
1106399716 13:29418088-29418110 GTGGTTTACCAGTTAGAGCAGGG - Intronic
1108675949 13:52738500-52738522 TTTGTTTTCCAGAGAGAGAAGGG + Intronic
1108730139 13:53226584-53226606 TAGGTGTAGAAGAGAGAGGAAGG - Intergenic
1110097315 13:71544190-71544212 TAGGTGTGGCAGAGAGAGAATGG + Intronic
1110524019 13:76514780-76514802 TAGGTTTGCATGACAGAGCACGG + Intergenic
1111296031 13:86278856-86278878 TAGATTTACCAGAGAGAGCAAGG + Intergenic
1112686342 13:101832251-101832273 TAAGTGCTCCAGAGAGAGCACGG + Intronic
1115198680 14:30829789-30829811 TATGTTTAACAGAGTGATCAAGG + Intergenic
1116530797 14:45971012-45971034 TGGGTCTACCAGAGAGAGTAGGG + Intergenic
1116987160 14:51232621-51232643 AAAGTTTAACAGAGAGATCAAGG + Intergenic
1117728718 14:58699580-58699602 GATGTTTATCAGAGAGAGAAAGG + Intergenic
1117736121 14:58770607-58770629 TACACTTACCAGATAGAGCAAGG - Intergenic
1118732968 14:68682254-68682276 TAGGTTTACCGGAGACAGATTGG - Intronic
1119682514 14:76603511-76603533 AAGGTTTACCAGGGAGAGTGCGG + Intergenic
1120566551 14:86066254-86066276 TAGTTTTACCAAATATAGCATGG + Intergenic
1121125517 14:91404250-91404272 TGCGGTTACCAGAGGGAGCAGGG - Intronic
1121772803 14:96564984-96565006 TAGGATTTGCAGGGAGAGCAGGG - Exonic
1122414636 14:101543012-101543034 GAGGTGGACCAGAGAGGGCAGGG - Intergenic
1202883322 14_KI270722v1_random:82062-82084 TTTGTTTACCTAAGAGAGCATGG + Intergenic
1126930845 15:53649264-53649286 TAGGTGTACCAGAGACTGTATGG + Intronic
1127742996 15:61931935-61931957 GAGGTTTACAAGAAAGAGTAAGG + Intronic
1128927975 15:71676001-71676023 AAGGATTCCCAAAGAGAGCATGG - Intronic
1131394112 15:92073101-92073123 GAGTTTTAGCAGAGAGAGCTTGG + Intronic
1133392110 16:5418996-5419018 CAGGTAGGCCAGAGAGAGCAAGG + Intergenic
1137976056 16:53033124-53033146 CAGATTAACAAGAGAGAGCAAGG - Intergenic
1140128818 16:72139625-72139647 GAGGTTTAGGAGAGAGTGCAAGG - Intronic
1141317617 16:82977176-82977198 TAGCAATCCCAGAGAGAGCAGGG - Intronic
1147868020 17:43566581-43566603 CAGGTTTACCAGGGAGTTCACGG + Intronic
1147889464 17:43707078-43707100 AAGTTTTACCTGAGACAGCAGGG + Intergenic
1149699300 17:58641967-58641989 TCGGCTTACCAGAAAGAACAGGG - Intronic
1152064362 17:78102308-78102330 TTGGTTTACCAAAGATAGCATGG + Intronic
1152850205 17:82629394-82629416 GAGGTTCCACAGAGAGAGCAGGG - Intronic
1154495156 18:14950703-14950725 GAGGTTTAACAGAGAGAGAATGG + Intergenic
1158221384 18:55154345-55154367 TAGGTTTACGAGAGGAGGCAAGG + Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1162234003 19:9291486-9291508 TAGATTTATCAAAGAGACCATGG - Intergenic
1162343348 19:10105654-10105676 TTGGGGTGCCAGAGAGAGCAAGG + Intergenic
1164082472 19:21871542-21871564 TATGTTTACCAGAAAGAAAATGG + Intergenic
1164190096 19:22907127-22907149 TATGTTTACCAGAAAGAGAAGGG + Intergenic
1202658734 1_KI270708v1_random:49206-49228 TTTGTTTACCTAAGAGAGCATGG + Intergenic
925687466 2:6487757-6487779 TACATGTTCCAGAGAGAGCATGG - Intergenic
927398843 2:22687328-22687350 AAGGTTTATCAGAGAGAGAGAGG + Intergenic
927724663 2:25412256-25412278 CAGCTATACCAAAGAGAGCATGG - Intronic
927769540 2:25847254-25847276 TAGATGTAGCAGAGAGATCAAGG - Intronic
930360963 2:50378961-50378983 TAGATTTTCCAGAGAGATTATGG + Intronic
932362449 2:71120266-71120288 TAAGTTCTCCAGAGAAAGCACGG + Intronic
941229661 2:162895830-162895852 TTGGTTTGCCAGAGAGAACCAGG - Intergenic
941566612 2:167116391-167116413 TAAATTTACCAGAGACAGAAAGG - Intronic
945004045 2:205384148-205384170 TAAGTTTGACAGAGAGAGAATGG + Intronic
945221504 2:207488946-207488968 TAGAGTTTCCAGAGAAAGCACGG - Intergenic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
947059340 2:226145099-226145121 GAGGTGTACCAGAAAGAGAAAGG - Intergenic
947320848 2:228916742-228916764 AAGGTTTACCAGACAGAGTAGGG + Intronic
948588279 2:239034870-239034892 TAGGTGGGCCAGGGAGAGCAGGG - Intergenic
948626459 2:239272021-239272043 AAGGTTTCACAGAGAGAGCTGGG - Intronic
1168785059 20:531526-531548 TACATTTACCAGAGAGTTCATGG - Intronic
1168815359 20:733050-733072 TAGGGCTTTCAGAGAGAGCATGG + Intergenic
1169951055 20:11043594-11043616 TGGGTTTCCAAGAGAGAACATGG - Intergenic
1171301294 20:24063157-24063179 TAGATTTAAGAGAGAGAGAAAGG - Intergenic
1176889320 21:14294940-14294962 TAGGTTTGCAAGAAAGAACATGG + Intergenic
1180122039 21:45759677-45759699 TTGGTTTTCCAGAAAGAGAAGGG + Intronic
1180326202 22:11432725-11432747 TTTGTTTACCTAAGAGAGCATGG + Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
951045007 3:18028294-18028316 TCCGTTTACAAGAGAGAGAAGGG + Intronic
951157020 3:19367907-19367929 TTGGCTTACAAGAGAGAGCATGG + Intronic
958573482 3:95917001-95917023 TTCGTTTTCCAGAAAGAGCAGGG + Intergenic
959738417 3:109687644-109687666 AAGGTTGAGCAGAAAGAGCATGG + Intergenic
960541687 3:118868953-118868975 TTGGTTTCCCAGAAAAAGCATGG + Intergenic
960606282 3:119508738-119508760 AAGGCTTTCCAGGGAGAGCAAGG - Intronic
961961020 3:130855184-130855206 TAGGATAACCAGAGTGAACATGG - Intronic
962443312 3:135443182-135443204 GAGATTTTGCAGAGAGAGCATGG - Intergenic
964833184 3:160909039-160909061 TAGGTTGCCAAGAGAGAACAGGG + Intronic
967706603 3:192658556-192658578 TAGCTTTACCCTAGAAAGCAGGG + Intronic
970009780 4:11446377-11446399 TAAGTTTGCCAGAGAGAGAAAGG + Intergenic
970551526 4:17186388-17186410 TAGGTGGACCAGATGGAGCAGGG + Intergenic
972038747 4:34561710-34561732 GAGGCATTCCAGAGAGAGCAAGG - Intergenic
973598495 4:52516794-52516816 TGGTTTTACCAGGGAGAGCTGGG - Intergenic
976921549 4:90449795-90449817 GAGGCTTCCCAGAGAGTGCATGG + Intronic
977273579 4:94948360-94948382 GAGTAGTACCAGAGAGAGCAAGG + Intronic
979712974 4:123802666-123802688 CAGCTGTACCATAGAGAGCAAGG - Intergenic
981300274 4:143178935-143178957 TCAGTTTACCAGAGAGAAGAAGG - Intergenic
982316546 4:154037666-154037688 AAGATTTACAAGACAGAGCAGGG + Intergenic
983495740 4:168440575-168440597 AAGGTTTTCCAGAGAGGACATGG - Intronic
984760126 4:183356574-183356596 TTGGTTGTCCAGAGAGAGCATGG - Intergenic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
990535523 5:56717707-56717729 TAGGTGTACCAGGGAAAGCCAGG + Intergenic
991350514 5:65716078-65716100 CAGGTTTAACAGAGAGTTCAGGG + Intronic
992167872 5:74072917-74072939 TAAGTTTACCAGAGAGAAGAAGG - Intergenic
992174611 5:74137404-74137426 TAGGTCTACCATACATAGCATGG + Intergenic
992952813 5:81877132-81877154 TAGTTTTATTAGAGAAAGCAGGG - Intergenic
993467156 5:88263251-88263273 TACATTTAACAGAGAGAGTAAGG - Intronic
994954702 5:106513015-106513037 AAGGTATACCAAAGAGAACAAGG - Intergenic
998329755 5:141314442-141314464 TAGGGTTACCAGAGAAAATAAGG + Intergenic
999479349 5:151932235-151932257 TTGGGTTAGCAGAGAGAGTATGG + Intergenic
999757321 5:154674356-154674378 CAGGTTTATCTGAGAGACCAGGG - Intergenic
1003076537 6:2988157-2988179 GAGGTTTTGCAGGGAGAGCAGGG + Intronic
1006954525 6:37855955-37855977 TAGGTCTAAAAGTGAGAGCAAGG - Intronic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1010051214 6:71506208-71506230 TGGGTTTACCATAGAGAGGAAGG + Intergenic
1010507965 6:76684163-76684185 CACGTTTACCAGACACAGCAGGG - Intergenic
1014729239 6:125011646-125011668 TAGTTTTATATGAGAGAGCAAGG + Intronic
1015514493 6:134070762-134070784 TGGGATTTTCAGAGAGAGCAGGG - Intergenic
1016262905 6:142194969-142194991 TAAGTTTACCAATGAGTGCAGGG - Intronic
1016767478 6:147811191-147811213 TGGGTGTACCAGAGAGTTCATGG + Intergenic
1016900524 6:149096717-149096739 TGGGCTTACCAGAAGGAGCAGGG - Intergenic
1019427880 7:985922-985944 TGGGTTCACAAGCGAGAGCAGGG + Intronic
1020646880 7:10825299-10825321 TAGTTTGTACAGAGAGAGCAAGG - Intergenic
1021234111 7:18121469-18121491 TAGGTTTAATAAAGAGAGAAAGG + Intronic
1023598601 7:41858557-41858579 TAGAAGTTCCAGAGAGAGCATGG - Intergenic
1024168094 7:46754935-46754957 TTGGTTTACCAGTGAAAACAGGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1024799443 7:53059234-53059256 TAGGTGGAAGAGAGAGAGCAGGG + Intergenic
1027573023 7:79895652-79895674 AAGTATTACCAGAGATAGCATGG - Intergenic
1029869758 7:103677952-103677974 TAGTTGGACCAGAGAGAGCAGGG - Intronic
1030897182 7:115075245-115075267 TAAGTTTAGTAGAGAGGGCATGG - Intergenic
1031311335 7:120201241-120201263 TATGTTTCCCAGAGTTAGCAGGG - Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1032360925 7:131253878-131253900 TTGGTTTACCAGGGAGAACCAGG + Intronic
1032862087 7:135889978-135890000 TAAATTTAGCAGAGAGATCAAGG - Intergenic
1033087662 7:138357263-138357285 TAGGATTCCAAGAGTGAGCAAGG + Intergenic
1033152145 7:138924844-138924866 TAGGTTCACAAAAGAGAGAAAGG + Intronic
1035763721 8:2088424-2088446 GAGGCCTACCAGACAGAGCAAGG - Intronic
1037702878 8:21290844-21290866 TAGGTTTATGAGCAAGAGCAGGG - Intergenic
1039040064 8:33399355-33399377 TAGGTGAACCAGAGAGCACAAGG - Intronic
1041318453 8:56588893-56588915 TAGGATCACGAGATAGAGCAAGG - Intergenic
1043944990 8:86239606-86239628 TAGAGTTGCCAGTGAGAGCATGG - Intronic
1045056124 8:98369835-98369857 GAGGTTTTCTAGGGAGAGCAGGG + Intergenic
1046259793 8:111752442-111752464 TAGGTGTGTCAGATAGAGCATGG + Intergenic
1047534014 8:125702793-125702815 TATTTTTACCAGAAAAAGCAAGG + Intergenic
1048164963 8:132054192-132054214 TAGGTATACCACAGTGGGCAAGG + Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1051046277 9:12878379-12878401 TAGGTTAACCATAGTGAGAAAGG - Intergenic
1051303617 9:15682128-15682150 TAGGTTTACTCGTGAGATCAAGG + Intronic
1053372506 9:37574878-37574900 TAGGTGTACAAGACAGAGTAGGG + Intronic
1056778063 9:89528442-89528464 GAGGAATCCCAGAGAGAGCAAGG + Intergenic
1058417854 9:104806454-104806476 TAGGATTACCAGAGATGGCCTGG + Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060075164 9:120584181-120584203 TAGGTTTGGCAGAAAGATCATGG - Intergenic
1186613114 X:11158114-11158136 TTGGTTTACCAGAGGGAACGTGG - Intronic
1187250536 X:17594209-17594231 ATGGTGTACCAGAAAGAGCATGG - Intronic
1187255480 X:17637949-17637971 TAGGCTTACCAGGGATAGGATGG + Intronic
1188261510 X:28030413-28030435 TAGGTTCTCCAGACAGAGGATGG + Intergenic
1190434124 X:50406712-50406734 TAGGGTCATCAGAGAAAGCATGG + Intronic
1192057073 X:67783931-67783953 TGGCTGTACCACAGAGAGCAAGG - Intergenic
1192292436 X:69811735-69811757 GAGGTTTTCTGGAGAGAGCAGGG + Intronic
1197331522 X:125158715-125158737 TAGATTCCCAAGAGAGAGCAAGG + Intergenic
1198619558 X:138491036-138491058 TGTGTTTGCCAGAGAGAGGATGG - Intergenic
1200641381 Y:5721389-5721411 TAGGTTTAGCAGAGACAACCAGG + Intronic