ID: 1089476147

View in Genome Browser
Species Human (GRCh38)
Location 11:118764439-118764461
Sequence GGTACAAAGTTGTTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089476147_1089476152 12 Left 1089476147 11:118764439-118764461 CCCATAGCAAACAACTTTGTACC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1089476152 11:118764474-118764496 TTTACCCAACTTTTTTCTTCAGG 0: 1
1: 0
2: 0
3: 43
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089476147 Original CRISPR GGTACAAAGTTGTTTGCTAT GGG (reversed) Intronic
902164118 1:14555834-14555856 TGTACAAAGGTGTTTGATGTGGG + Intergenic
907288688 1:53398565-53398587 GGTCAAAAGGTGTTTGCTTTTGG + Intergenic
908466413 1:64400434-64400456 GGTAAATAGTTATGTGCTATGGG - Intergenic
908856505 1:68435719-68435741 GGAACATAGTTATTTGCAATGGG - Intronic
919511404 1:198469844-198469866 AGTAGAAAGTTGGTTGCTAGAGG + Intergenic
921347769 1:214204644-214204666 GGAGCAAATTTGTTTGCTACTGG - Intergenic
923115065 1:230928689-230928711 GTTAAAATGATGTTTGCTATAGG + Intronic
1064897996 10:20261268-20261290 GGGAAAAAGTTCTTTGATATAGG - Intronic
1065692503 10:28349908-28349930 GCTACAAAGAAGTTTGTTATAGG + Intergenic
1066506912 10:36054988-36055010 GATACAATATTGTTAGCTATAGG + Intergenic
1070369982 10:75773097-75773119 GGTAGAAAATTGTTTGTTATGGG + Intronic
1080122314 11:28692001-28692023 GGTACAATGTTGTTTAGCATAGG + Intergenic
1080903768 11:36520785-36520807 GGGACAAAGTTGATAGCTATTGG + Intronic
1086865178 11:91971758-91971780 GGTACAAAGTTGTATGGGAGAGG + Intergenic
1088574325 11:111255485-111255507 AGAAGAAAGTTGTTTGTTATTGG - Intergenic
1089476147 11:118764439-118764461 GGTACAAAGTTGTTTGCTATGGG - Intronic
1092992357 12:13915248-13915270 GGAACTATGTTGTTTGCTTTTGG - Intronic
1096027002 12:48375096-48375118 AGTACTCAGCTGTTTGCTATGGG + Intergenic
1097049409 12:56212681-56212703 GGTCCAGAGTTGGTTGCCATTGG + Intronic
1100745052 12:97636308-97636330 GGTACAAAGTTGCTTAGTATCGG - Intergenic
1103179494 12:118897557-118897579 TGTAAAAAGTTGTTTTCTCTGGG + Intergenic
1103353374 12:120301440-120301462 AGTATCAAGTTATTTGCTATTGG - Intergenic
1108159235 13:47620696-47620718 GGGACAAAGCTGTTTTCTACAGG - Intergenic
1116579857 14:46626394-46626416 TGTACAAAGATGTCTTCTATGGG + Intergenic
1117708904 14:58502777-58502799 GGAACAAATTAGTTTTCTATAGG - Intronic
1118372520 14:65149610-65149632 AGTCCAAACTTGTTTGATATAGG + Intergenic
1119564735 14:75618921-75618943 GTTACAAAGTTATTGGCGATAGG + Intronic
1121984450 14:98489879-98489901 GGTACAAAGTTGTTTTATTGTGG - Intergenic
1122129456 14:99596696-99596718 GGAACAAACTTGTCTGCTAAAGG - Intronic
1124434687 15:29637351-29637373 GGTACAAATGTGCTTGCAATGGG + Intergenic
1127184878 15:56467732-56467754 GGTAAAAAGTTGTTTTCTAGAGG - Intergenic
1131764897 15:95665104-95665126 GGTGCACAGGTATTTGCTATTGG + Intergenic
1133510506 16:6452890-6452912 GGTGCAAAGCTGTGTGCTAAGGG - Intronic
1133629067 16:7601897-7601919 GGTACAAAGGTGTTTTGTTTGGG - Intronic
1137702074 16:50504451-50504473 GGGACAAAGCTGTTTGTTACTGG + Intergenic
1138859234 16:60735301-60735323 GGTAGAATGTTCTTTGCCATTGG - Intergenic
1140656200 16:77142701-77142723 GGTACAAATTTGTGTGGTAAGGG + Intergenic
1141361420 16:83398436-83398458 GTTACAAAGACATTTGCTATTGG + Intronic
1144164483 17:12596230-12596252 GCTAAAAAGTTCTTTGCTCTTGG + Intergenic
1144446195 17:15331515-15331537 GGTAGAAAGTTGGTTGGTGTTGG + Exonic
1146730577 17:35190603-35190625 GGTACAAAGTTGAATACAATTGG - Intergenic
1151005058 17:70425825-70425847 GTAACAAAGTTGTTTGCTCCAGG - Intergenic
1151366350 17:73618831-73618853 GGTTCATAGTTGTTAGCTGTGGG - Intronic
1151472226 17:74325652-74325674 GGTAGAGACTTGTTTGCTAGTGG + Intergenic
1153096363 18:1410090-1410112 GGTAGAAAGTTGTTATCTTTGGG + Intergenic
1155831676 18:30523459-30523481 GGTAGACAGTAGTTGGCTATAGG + Intergenic
1155884719 18:31193658-31193680 GGTACTAAGTTTCTTGCCATTGG + Intergenic
1158288670 18:55914167-55914189 AATAAAAAGTTTTTTGCTATGGG + Intergenic
1159310451 18:66700976-66700998 GGAACAAAGTATTTTGCAATTGG + Intergenic
1167718883 19:51163692-51163714 AGTAGAAAGTTGGTTGCCATGGG + Intergenic
925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG + Intronic
925643604 2:6011689-6011711 GTTACAATTTTTTTTGCTATGGG - Intergenic
928682235 2:33714397-33714419 GGTTGTAAATTGTTTGCTATCGG + Intergenic
930670315 2:54143242-54143264 AGTAAAAAGATGTTTGCTGTTGG + Intronic
932982132 2:76681797-76681819 TGTCCAAAGTTGCTTGCTACTGG - Intergenic
936878228 2:117218111-117218133 TGTACAAAGTTGTTTCCCAAAGG + Intergenic
944112877 2:196153272-196153294 TGTACTAAGTAGTTTGCTGTTGG + Intronic
947262196 2:228235808-228235830 GGTACATATTTGTTTTCTAACGG + Intergenic
1170432786 20:16292275-16292297 GGTAAAAAGTTGTGTGGAATTGG + Intronic
1177228661 21:18290120-18290142 GGAACAATGTTTTTTGTTATTGG + Intronic
1179543675 21:42100658-42100680 GGTACAAAATTGATCTCTATTGG + Intronic
949707971 3:6840673-6840695 GGTACAAATTTATTTAATATAGG + Intronic
961760009 3:129160320-129160342 GGTACAAAGATGATTGGTACCGG - Intronic
964001244 3:151775076-151775098 GGGTCACACTTGTTTGCTATGGG - Intergenic
970568009 4:17351429-17351451 AGTACAGAATTATTTGCTATTGG - Intergenic
972404077 4:38730287-38730309 GGAACAAAGTTGATTGCCCTGGG - Intergenic
973017799 4:45163380-45163402 GGTACAACATTGTTAGCTTTAGG + Intergenic
977003714 4:91537752-91537774 GGTATATTGTTGATTGCTATGGG - Intronic
977460713 4:97321457-97321479 GGTAATAATTTGTTTGGTATAGG - Intronic
979389292 4:120108551-120108573 GCTACAATTTTGTTTTCTATAGG - Intergenic
983097332 4:163579442-163579464 GCTACTTAGGTGTTTGCTATGGG - Intronic
986511841 5:8515658-8515680 GAAACAAAGTTGTTTTCTGTGGG - Intergenic
986837302 5:11652890-11652912 AGTAGAAAGATGATTGCTATGGG - Intronic
989632777 5:43503664-43503686 GGTACAAAGGTGTTACATATAGG - Exonic
990196402 5:53321666-53321688 GGTACAAATTCATTTGCTACTGG - Intergenic
994563980 5:101416673-101416695 TGGACAAAGTTGTTTCCCATGGG + Intergenic
996563218 5:124852771-124852793 AATACAAAGGTGTTTGCAATAGG + Intergenic
1002202853 5:177540417-177540439 GATACAAAGTTGTAGGATATAGG - Intronic
1013372275 6:109481603-109481625 TGTTCAAAGTTGTTGGCTTTGGG + Exonic
1016226501 6:141745798-141745820 GATACAAAATTGATTGCTTTTGG - Intergenic
1016931726 6:149417795-149417817 TGTATGAAGTTATTTGCTATGGG - Intergenic
1018660133 6:166078254-166078276 GGTACAAGGTTGCTTGCACTGGG + Intergenic
1021368710 7:19814121-19814143 GTTATAAAGTTGTTTCCCATGGG + Intergenic
1028674246 7:93440758-93440780 AGTACAAAATTGTTACCTATAGG + Intronic
1028784523 7:94776616-94776638 GGAAGAAAGTTGTTTCCTTTAGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1041245729 8:55886569-55886591 GGTAAAATGTTTCTTGCTATGGG - Intronic
1041810322 8:61901832-61901854 CATACAGAGTTGTCTGCTATGGG - Intergenic
1043314636 8:78905187-78905209 TTTGCAAAGTTGTGTGCTATGGG + Intergenic
1046729104 8:117706110-117706132 GCTACAAAGTTTTTTGGTATGGG - Intergenic
1046831759 8:118753977-118753999 GCTACAAATTTGTGTGTTATGGG + Intergenic
1048913541 8:139159903-139159925 GGTTCCAAGTCTTTTGCTATTGG + Intergenic
1050744829 9:8863192-8863214 GGTACAATGCTATTTGCTACTGG + Intronic
1051293602 9:15570935-15570957 GGTACCCAGTTGTGTGGTATAGG + Intronic
1051338599 9:16090653-16090675 GGTGAGAAGTTGTTTGCTTTGGG - Intergenic
1055460219 9:76512300-76512322 GGTAGAAAGTTGGTTGCCAGCGG - Intergenic
1187105542 X:16237809-16237831 GGTAAAGAGTTATTTCCTATGGG - Intergenic
1189350970 X:40275455-40275477 GGTGCAATGTTGTTGGCTGTTGG + Intergenic
1189392362 X:40586876-40586898 GGGGCAAAGTTATTTGGTATAGG + Intronic
1190461504 X:50681068-50681090 GGTAAAAAGTTGTTAGATTTAGG - Intronic
1190541971 X:51486323-51486345 AGTAGAAAATTGTTTGCTAAAGG - Intergenic
1196536033 X:116845534-116845556 GGTACACTGTTATATGCTATGGG + Intergenic
1196629541 X:117921287-117921309 GGTACAGAGATGTATGCTTTAGG + Intronic
1199598364 X:149525633-149525655 GCTACCAAGCTGTTTGCTAGGGG + Intronic
1199837250 X:151603881-151603903 AGATCAAAGTTGTATGCTATGGG + Intronic
1199870742 X:151896206-151896228 AGAGCAAAGTTGTTTTCTATAGG - Intergenic