ID: 1089477637

View in Genome Browser
Species Human (GRCh38)
Location 11:118778369-118778391
Sequence CCTTACAACAAAGAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 5, 3: 94, 4: 475}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089477637 Original CRISPR CCTTACAACAAAGAATTTTG TGG (reversed) Intronic
901255788 1:7825240-7825262 TCTAACAACAAAAGATTTTGTGG - Intronic
901746810 1:11379168-11379190 TCCTACGACAAAGAATTATGTGG + Intergenic
901747372 1:11383160-11383182 CCCTACAACAAAGAATTATCTGG + Intergenic
902171192 1:14612667-14612689 CCCCACAACAAAGAATTATCTGG - Intronic
903749334 1:25611004-25611026 CCCTACAACAAAGAATTATCGGG - Intergenic
903980136 1:27180321-27180343 TATTACAAAAAAGAATTCTGAGG + Intergenic
904950228 1:34231716-34231738 CCTCACTACAAAGAATTATTTGG + Intergenic
905084818 1:35363347-35363369 CTTCACAACAAAGAATTATCTGG - Intronic
905784142 1:40739440-40739462 CCTCACAACAAAGAATTATCTGG - Intronic
906068541 1:43000283-43000305 TCTTACAACAAAGAGTTATCTGG - Intergenic
906203215 1:43972935-43972957 CCCCACAACAAAGAATTATCTGG - Exonic
906422523 1:45682570-45682592 CCATAAAACAAAGAACTTTACGG - Intronic
906587817 1:46995183-46995205 CCTTACAACAGAAAAAATTGAGG - Intergenic
906871879 1:49492042-49492064 CAGTACAATAAAGTATTTTGAGG - Intronic
906905860 1:49891509-49891531 CCCCACAACAAAGAATTATCTGG + Intronic
907190768 1:52646213-52646235 CCTCACAACAAAGAATTATCTGG + Intronic
907873195 1:58461922-58461944 CCTCACACCAAGGAATTGTGGGG + Intronic
907976127 1:59433138-59433160 CCCCACAACAAAGAATTATCTGG - Intronic
908744370 1:67361226-67361248 CCTTTCAACAAAAAATTATAAGG + Intronic
909158083 1:72106397-72106419 CCTATGAACAAAGAACTTTGGGG - Intronic
909425869 1:75523873-75523895 CTTAAAAACAAAGAATTTTCTGG + Intronic
909989969 1:82211536-82211558 CCCTACAACAAAGAATTATCTGG + Intergenic
910423497 1:87096597-87096619 CCCCACAACAAAGAATTATCTGG - Intronic
910564258 1:88625577-88625599 CCCCACAACAAAGAATTGTCTGG + Intergenic
910764719 1:90770202-90770224 CCCCACAACAAAGAATTATCTGG - Intergenic
911361315 1:96880873-96880895 CCTTCCAACAAAGAATTGTTAGG + Intergenic
911711026 1:101073278-101073300 CCGCACAACAAAGAATTATCTGG - Intergenic
912083020 1:105961689-105961711 GATTTCAACAAATAATTTTGGGG - Intergenic
912923480 1:113892178-113892200 CCTCACAACAAAGAATTATCTGG + Intergenic
913265833 1:117043151-117043173 CCTAACAACAAAGAATTGTCTGG + Intergenic
913335630 1:117706994-117707016 CCTCACCACAAAGAATTATCTGG - Intergenic
913475978 1:119238222-119238244 CCTTACTACAAAAAATTTTAAGG - Intergenic
915926148 1:160021181-160021203 CCCCACAACAAAGAATTATCTGG - Intergenic
915952198 1:160196976-160196998 CCCTACTACAAAGAATTATCTGG + Intronic
916011007 1:160705776-160705798 CCCTACAAAAAAGAATTATGTGG - Intronic
916091024 1:161307968-161307990 ACTTACAACAAATAGTTTTGTGG + Intronic
916125655 1:161568649-161568671 CCCCACAACAAAGAATTATCTGG - Intergenic
916135570 1:161650480-161650502 CCCCACAACAAAGAATTATCTGG - Intronic
916155052 1:161836795-161836817 CATTACAACAATGAAGTGTGGGG - Intronic
916194217 1:162208531-162208553 CCTTACAACAAACAATTATCTGG - Intronic
917043144 1:170828721-170828743 CCTCACAACAAGGAATTATCTGG - Intergenic
917089175 1:171335825-171335847 CCTTAAAAAACAGAAATTTGTGG - Intronic
917277640 1:173347799-173347821 TTTTACAAAAAAGAATTATGTGG - Intergenic
917427703 1:174932620-174932642 CCTGACAAATAAGAATTTTGTGG + Intronic
917766939 1:178230624-178230646 CCTCAGAAGAAAGAATTTAGGGG + Intronic
917828181 1:178846549-178846571 CATATCAACAAAGAATTTAGAGG - Intronic
918911907 1:190584137-190584159 CCTTACCACAAAAAATGATGAGG + Intergenic
919395321 1:197039308-197039330 CCTTATAAAATATAATTTTGAGG - Exonic
919712802 1:200745153-200745175 CCCAACAACAAAGAATTATCTGG - Intronic
920723061 1:208406653-208406675 CCCCACAACAAAGAATTATCAGG - Intergenic
923078575 1:230632392-230632414 CTCTACAACAAAGAATTATCTGG - Intergenic
924207031 1:241723475-241723497 CCTTCCAACAGATAATTTTCCGG - Intronic
1063539010 10:6913339-6913361 CCTGACAACAAGGAATTATTTGG - Intergenic
1063653182 10:7960812-7960834 CCTCACAACAAAAGCTTTTGTGG + Intronic
1065337079 10:24663828-24663850 CCCCACAACAAAGAATTATCTGG - Intronic
1065378687 10:25067368-25067390 GCTTAAAATAAAGAATTTTCTGG - Intergenic
1066073715 10:31849368-31849390 ACTTACAACAAAAATTTTTAGGG + Intronic
1070144018 10:73760611-73760633 CCTAAAAACATAGAATTATGAGG - Intronic
1070195589 10:74153366-74153388 CCCCACAACAAAGAATTATCTGG + Intronic
1070573224 10:77657342-77657364 CCTGACAACAAAGAATTTTCTGG + Intergenic
1071848245 10:89541688-89541710 CCCCACAACAAAGAATTGTCAGG - Intronic
1072505058 10:96057523-96057545 CCTAACATCATTGAATTTTGGGG + Intronic
1073510685 10:104040716-104040738 CCGTACAACATAGAAACTTGTGG - Intronic
1074099832 10:110346067-110346089 CCTGGAAACAAAGAGTTTTGGGG - Intergenic
1074614160 10:115049607-115049629 CCCGACAACAAAGAATTATCTGG + Intergenic
1075903604 10:126062779-126062801 CCTTTCCAAAAAGCATTTTGTGG - Intronic
1077202787 11:1320085-1320107 CCTTTCAACAAAGAATTACAAGG + Intergenic
1077702338 11:4453926-4453948 CCTCAGAAAAAAGAATTTTGAGG - Intergenic
1077965053 11:7121240-7121262 CTTTACAATTAAGTATTTTGTGG - Intergenic
1078405083 11:11063487-11063509 CATTTCAACAAAGGATTTGGAGG + Intergenic
1079226746 11:18613470-18613492 CCTGACAGCAAAGAATTATCTGG - Intronic
1080755990 11:35199437-35199459 CCTTAGAAAAAAGGCTTTTGGGG + Intronic
1080930434 11:36804626-36804648 GCCCACAACAAAGAATTTTCTGG + Intergenic
1081295921 11:41389234-41389256 ACTTACACCACAGCATTTTGTGG - Intronic
1082079231 11:47999327-47999349 CCTTCCAAAAGAGATTTTTGTGG - Intronic
1083235531 11:61348509-61348531 CCTTTCAACACAGGAATTTGGGG - Exonic
1083393913 11:62375210-62375232 CTTTAAAACAAAGAGTTGTGGGG + Intronic
1083860593 11:65418112-65418134 CTTTACAGGAAAGAACTTTGCGG - Intergenic
1085058054 11:73419465-73419487 CCCCACAACAAAGAATTATTTGG + Intronic
1085107596 11:73859106-73859128 CCCTACAACAAAGAATTATCTGG + Intronic
1085441797 11:76571029-76571051 CCTAATGACAAATAATTTTGAGG + Intergenic
1085782750 11:79424279-79424301 CCCTACAACAAAGAATTATCTGG + Intronic
1086039541 11:82459235-82459257 CCTGACAACAAAGAATTGTCTGG - Intergenic
1086278372 11:85158524-85158546 CCTTACAAAATAGATTTGTGAGG + Intronic
1086346156 11:85899419-85899441 CCTCACAACAAAGAATTATCTGG - Intronic
1086498364 11:87426843-87426865 CCCCACAACAAAGAATTATCTGG + Intergenic
1086545674 11:87965017-87965039 CCATATAACAAAGAATTATCTGG - Intergenic
1086561471 11:88174654-88174676 CCTTAAGACAAAGGAGTTTGAGG - Intronic
1086922471 11:92602844-92602866 CCTGTGAACAAAGAATTTGGTGG + Intronic
1087521686 11:99245776-99245798 CCCTACAACAAAGATTTATCTGG - Intronic
1087721472 11:101670669-101670691 CCCCACAACAAAGAATTATCTGG + Intronic
1088289463 11:108221283-108221305 CCCCACAATAAAGAATTATGAGG + Intronic
1089477637 11:118778369-118778391 CCTTACAACAAAGAATTTTGTGG - Intronic
1089477921 11:118780791-118780813 CTTTACAACAAAGAATTTTGTGG - Intronic
1089741659 11:120588705-120588727 CCCCACAACAAGGAATTGTGCGG - Intronic
1091633512 12:2180109-2180131 CCTTACAACAGACACTGTTGGGG - Intronic
1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG + Intronic
1092596889 12:10016498-10016520 CTATAAAACAAAAAATTTTGAGG + Intronic
1092811771 12:12277372-12277394 CTTTTCAACAAAAAATTATGAGG + Intergenic
1092913803 12:13171680-13171702 TCTTACTACAAACAATTTTTTGG + Intergenic
1093026217 12:14247912-14247934 CGCTTCAACATAGAATTTTGAGG - Intergenic
1093238839 12:16643308-16643330 TCTTACAACAAAGAATTATCAGG - Intergenic
1093876253 12:24352922-24352944 TCTTTGAACAAAGAATTATGAGG + Intergenic
1094095827 12:26703479-26703501 CCTCCCAACAAAGAATTATCGGG - Intronic
1094261622 12:28507319-28507341 CCCCACAACAAAGAATTATCTGG - Intronic
1094372872 12:29757294-29757316 CCCTACAACAAAGAATTATCTGG - Intronic
1095669116 12:44837273-44837295 CCCCACAACAAAGAATAATGTGG - Intronic
1096333462 12:50734896-50734918 CCTTTCAACAAAAAATTATCTGG + Intronic
1096566135 12:52480822-52480844 TCTTAAAACAAAAAATTTTGTGG + Intergenic
1096893361 12:54794665-54794687 TCATTCAACAATGAATTTTGGGG - Intergenic
1096970270 12:55659895-55659917 CCCCACAACAAAGAATTATCTGG - Intergenic
1097442611 12:59629242-59629264 CCTTAAAAATATGAATTTTGGGG + Intronic
1097685900 12:62690669-62690691 CCCTACTACAAAGAAACTTGGGG + Intronic
1097903501 12:64896906-64896928 CCCAACAACAAAGAATTATCTGG + Intergenic
1098240295 12:68460398-68460420 CCCCACAACAAAGAATTATCTGG - Intergenic
1098817058 12:75180301-75180323 CCATTCAACAAACATTTTTGAGG - Intronic
1099484605 12:83213302-83213324 CCTCACAACAAGGAATTATCTGG - Intergenic
1099729558 12:86483401-86483423 ACTTCAAACTAAGAATTTTGGGG - Intronic
1101166534 12:102040623-102040645 ACTTACAATAAAGAATACTGGGG + Intronic
1101313120 12:103602095-103602117 CTTGACAACACAGAATTTGGGGG - Intronic
1101317844 12:103645780-103645802 CCTCACAACAAAGAACTGTCTGG - Intronic
1101470126 12:104988035-104988057 CCTTTAAAAAAAAAATTTTGGGG + Intronic
1101988299 12:109464312-109464334 TCTTACAACTAAGAATTATCTGG - Intronic
1102706747 12:114887687-114887709 CCCCACAACAAAGAATTACGTGG + Intergenic
1103025479 12:117570399-117570421 CCCCACAACAAAGAATTATCTGG + Intronic
1104173540 12:126305647-126305669 CCTTAAAACAAGTCATTTTGTGG - Intergenic
1106801750 13:33263156-33263178 CCCCACACCAAAGAATTATGTGG - Intronic
1107066263 13:36216830-36216852 CTCTACAACAGAGAATTATGTGG + Intronic
1107498564 13:40953320-40953342 CATGTCAACATAGAATTTTGGGG - Intronic
1107554158 13:41502934-41502956 CGTTATAATAAAGATTTTTGTGG - Intergenic
1107595165 13:41956136-41956158 CCTCACAACAAAAAATTATCTGG - Intronic
1107597382 13:41976896-41976918 CCTTGCAACAAAGAATGATCTGG + Intergenic
1107649761 13:42533559-42533581 GCTTAAAACAAACAATTTTCTGG + Intergenic
1108595858 13:51948588-51948610 CCCTACAACAAAGAGTTATCTGG - Intronic
1109710168 13:66148877-66148899 CCATACAACAGAGAATTATCTGG + Intergenic
1110003571 13:70236987-70237009 CCTTACAACAAGAAATTATTTGG + Intergenic
1110414122 13:75233975-75233997 CCACAAAACAAAGAATTTTCTGG - Intergenic
1110466850 13:75812184-75812206 CCCTACAACAAATAGTTTTCTGG + Intronic
1111187325 13:84755856-84755878 CCATACAATAAAGATTTTTTTGG + Intergenic
1111557302 13:89897328-89897350 CTTTACAACAAAGAATTATCTGG - Intergenic
1111664447 13:91249415-91249437 CCCCACAACAAAGAATTATCGGG - Intergenic
1111687663 13:91521317-91521339 CCCTACAACATTGAATATTGTGG - Intronic
1111748687 13:92299204-92299226 ACTTACAACAAAGATCTTTATGG + Intronic
1112659360 13:101490062-101490084 AATTTCAACACAGAATTTTGGGG - Intronic
1113403890 13:110020486-110020508 CCTTGCAACACAGACCTTTGTGG + Intergenic
1113549396 13:111180550-111180572 CCTTACAACACAGCCTTCTGGGG - Intronic
1115352573 14:32411204-32411226 CTCCACAACAAAGAATTTTCTGG + Intronic
1115788758 14:36856010-36856032 CCTTGCAACAAAGAATTATCTGG + Intronic
1116104751 14:40487569-40487591 CCTTGCCAAAAGGAATTTTGAGG - Intergenic
1116459057 14:45149937-45149959 CCCCACAACAAAGAATTATCTGG + Intronic
1116481847 14:45400647-45400669 CCTCACAACAAAGAAATATCTGG - Intergenic
1116832563 14:49736709-49736731 CCTCATGACAAAGAATTATGTGG - Intronic
1116878510 14:50139483-50139505 CATCACAACAAAGAATTATTTGG + Intronic
1117527294 14:56622006-56622028 CCATACAACAAACACTTTTATGG - Intronic
1118432555 14:65734869-65734891 CCTCACAACAAAGAATTCTCTGG - Intronic
1118697233 14:68397118-68397140 CATTACAGTAAAGAATTATGAGG - Intronic
1120267382 14:82268501-82268523 CCTCACAACAAGGAATTATCTGG - Intergenic
1120447678 14:84621500-84621522 CTTTTCAACAAATAATGTTGAGG + Intergenic
1121099716 14:91242243-91242265 CCATCCAACAAATAATTCTGGGG - Intronic
1121644255 14:95507085-95507107 CCTTACAGCAAAGAGAGTTGAGG + Intergenic
1122585866 14:102806156-102806178 CCCTACAGCAAAGAGTTTTCGGG + Intronic
1124828412 15:33123547-33123569 CCCTAAAACCAAGAATATTGAGG + Intronic
1125449772 15:39796115-39796137 CCTCACAACAAAGAATTATCTGG - Intergenic
1125473346 15:40025727-40025749 CCCTACAACAGAGAATTATTTGG - Intronic
1125639338 15:41216800-41216822 CCTTACAAGAAACAATATTTGGG + Intronic
1125816677 15:42591083-42591105 CCCCACAACAAAGAATTATATGG - Intronic
1126369027 15:47926353-47926375 CCCTGCAACAAAGAATTATCTGG + Intergenic
1127381466 15:58434174-58434196 CCTCACAACAATGAATTGTCTGG + Intronic
1128195655 15:65752799-65752821 CCTTAAAACAAAGTTTTTGGTGG - Intronic
1128855661 15:71011950-71011972 CCCCACAACAAAGAATTATCTGG - Intronic
1129347087 15:74928904-74928926 CCCTACAACAAAGAATTATCTGG + Intronic
1129961649 15:79691998-79692020 CCTTGCAAAAAAGATTTGTGAGG - Intergenic
1130068647 15:80628124-80628146 CCTGAGAACAAGGAATTCTGTGG - Intergenic
1130259054 15:82340207-82340229 GCTTAAAACAAAGAATCTAGGGG - Intronic
1130595865 15:85249734-85249756 GCTTAAAACAAAGAATCTAGGGG + Intergenic
1130631209 15:85570625-85570647 CCCTACAACAAAGAATTATCAGG - Intronic
1131088459 15:89599081-89599103 CCCTACAACGAAGAATTATCTGG - Intronic
1131337540 15:91563712-91563734 CCTTACAAGGAAGATTATTGAGG + Intergenic
1134005400 16:10815629-10815651 CCTTACAGCAAAGAAGTATCTGG + Intronic
1134836110 16:17362553-17362575 TCTTACAAGCAAGACTTTTGAGG - Intronic
1135389342 16:22076493-22076515 CCCCACAACAAAGAATTATCTGG + Intronic
1137339992 16:47592082-47592104 CCCAACAACAAAGAATTATTTGG + Intronic
1138878161 16:60978552-60978574 CCCTACAACAAATAATTATATGG - Intergenic
1138928597 16:61623346-61623368 CCCAACAACAAAGAATTATATGG - Intergenic
1139709861 16:68767688-68767710 CTCTCCAACAAAGAATTTTGAGG + Intronic
1139802302 16:69533122-69533144 TCCTAAAACAAAGAATTATGTGG - Intergenic
1140525417 16:75618840-75618862 CCCCACAACAAAAAATTTTCTGG - Intronic
1140899236 16:79352737-79352759 CCCTACCACAAAGGATTATGTGG - Intergenic
1141242880 16:82279173-82279195 CCTTACAATTATGAATATTGAGG - Intergenic
1142225681 16:88876514-88876536 ATTTTCAGCAAAGAATTTTGGGG - Exonic
1142274323 16:89108483-89108505 ATTTACAATAATGAATTTTGCGG - Intronic
1143307331 17:5957907-5957929 GCTTACCTCAAAGAAATTTGGGG - Intronic
1143406268 17:6679053-6679075 TCTTACAACAAAGAAGTATTCGG + Intergenic
1144113182 17:12059017-12059039 CCTTAAAAAAAGGATTTTTGGGG + Intronic
1148205568 17:45777648-45777670 CCTCACAACACAGAATTATCTGG - Intergenic
1149225216 17:54462526-54462548 CCTTACAACAAATAATGTCGAGG - Intergenic
1149291521 17:55222651-55222673 CTCTACAACAAAGGATTTTGTGG + Intergenic
1149382654 17:56109365-56109387 CCTCACAACAAAGAATTATCTGG - Intergenic
1149433710 17:56616244-56616266 CCTTCCAACAAACAATTGTCTGG - Intergenic
1149508579 17:57217097-57217119 CCTTCCAACAAAAAATTATGAGG + Intergenic
1149517072 17:57288803-57288825 CCTTGCAACAAAGAATAATCTGG - Intronic
1150678655 17:67266467-67266489 CCTAAAAACAAGGAATTATGTGG + Intergenic
1150723853 17:67635990-67636012 CCTCACAACAAAGAATTATCTGG + Intronic
1150902289 17:69293969-69293991 CTTCACAACAAAGAATTATCAGG + Intronic
1150913120 17:69409934-69409956 CCCCACAACAAAGAATTATCTGG - Intergenic
1150977176 17:70101263-70101285 TCCCACAACAAAGAATTTTCTGG + Intronic
1151275657 17:73032145-73032167 CCTGACAACAAAGAATTATCTGG + Intronic
1152338662 17:79712343-79712365 ACTTACATTAAAAAATTTTGAGG + Intergenic
1153736627 18:8077255-8077277 CTTTACAACATATAATTTTGTGG - Intronic
1153885800 18:9464702-9464724 CATTTCAACATACAATTTTGAGG - Intergenic
1154935158 18:21047400-21047422 CCCAACAACAAAGAATTATCTGG + Intronic
1156189930 18:34706970-34706992 CCTAACAATAAAGCACTTTGTGG + Intronic
1156862694 18:41856612-41856634 CCCCACAACAAAGAATTGTTAGG - Intergenic
1157149286 18:45199699-45199721 CCATACAACCAAGAGGTTTGAGG - Intergenic
1157522353 18:48353989-48354011 CCTTACTTCAATGAATTATGTGG + Intronic
1157802671 18:50633623-50633645 CCTTAGATCAAAGTGTTTTGGGG - Intronic
1157882864 18:51338364-51338386 CCTCACAAGAAAGAATTATCTGG - Intergenic
1158968355 18:62643458-62643480 CCTTTCAAGAAAGAATTTAAGGG + Intergenic
1159159062 18:64620497-64620519 CCTTACAACAGCCGATTTTGGGG + Intergenic
1159270407 18:66141983-66142005 CCCTACAACAAAGCATTATTTGG - Intergenic
1160307185 18:77750963-77750985 ACTTACTACAAAGACATTTGAGG - Intergenic
1160409711 18:78667582-78667604 CCTTTCAACATGGATTTTTGAGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1163388880 19:17017519-17017541 CCTTACAGCAAAGAAGGATGTGG - Intronic
1163759949 19:19130769-19130791 CTCTACAAAAAATAATTTTGTGG + Intronic
1163866193 19:19775443-19775465 CCTGAGAACACAGAATTTTAGGG + Intergenic
1165588708 19:36946495-36946517 TATTTAAACAAAGAATTTTGAGG - Intronic
926576904 2:14592607-14592629 CATTTCAACAGAGAATGTTGAGG + Intergenic
927064342 2:19455870-19455892 CCATACAACAAATAATTATTTGG + Intergenic
928843965 2:35646078-35646100 CCCCACAACAAAGACTTTTCTGG + Intergenic
928997341 2:37307042-37307064 CCATACAACAAAGCATTATCTGG - Intronic
929089440 2:38200436-38200458 CCTTAGAACAAAGAACTTGGAGG - Intergenic
930276867 2:49321376-49321398 ACTTATAACAATGTATTTTGGGG + Intergenic
930874333 2:56197237-56197259 TCTCACAACAAAGAATTATCTGG - Intronic
931939755 2:67239090-67239112 CCTCACAATAAAGAATTATCTGG + Intergenic
931979219 2:67676700-67676722 CGTTTGAACAAAGAATTTTATGG + Intergenic
932105029 2:68934335-68934357 CCCTACAACAAAGAATGTTCTGG - Intergenic
932860523 2:75286716-75286738 CCTCACAACAAAGAATTATCTGG + Intergenic
932909341 2:75789487-75789509 CCCCACAACAAAGAATTATCTGG - Intergenic
932909535 2:75791374-75791396 CCTCACAACAAAAAATTATCTGG + Intergenic
933290676 2:80435020-80435042 CTTCACAACAAAGAATTATCAGG - Intronic
933570594 2:84006013-84006035 CCTTACAACAAAAAATTATAAGG + Intergenic
933687757 2:85157001-85157023 CCTCACAACAAAGAATTATCTGG + Intronic
933842579 2:86299302-86299324 CCTCACAACAAAGAATTGTCTGG - Intronic
935017090 2:99193599-99193621 GCTTACAACACATAATTGTGTGG + Intronic
935036254 2:99377404-99377426 CCCAACAACAAAGAATTATCTGG - Intronic
935620994 2:105129408-105129430 CCCCACAACAAAGAATTATATGG + Intergenic
935913697 2:107925849-107925871 CCTGACAACAAATAATTATATGG - Intergenic
936249064 2:110853298-110853320 GCTCACAACAAAGAATTATCTGG + Intronic
937438474 2:121897907-121897929 TCTTCCACCAAAGAATTTTGGGG + Intergenic
937764775 2:125648007-125648029 CTTTACAAAGCAGAATTTTGAGG + Intergenic
938773544 2:134521489-134521511 CCTGACAACAAAGAATTATCTGG + Intronic
938793505 2:134698081-134698103 CCTCACAGCAAAGAATTATCTGG - Intronic
939414744 2:141881330-141881352 TTTTACAACAAACAATTGTGAGG + Intronic
940021352 2:149159412-149159434 CCTTACAACATACATTTCTGTGG + Intronic
940124094 2:150304542-150304564 CTCTACAACAAAGAATTATCTGG - Intergenic
940572089 2:155449769-155449791 CCTTAGAACTAAGAATATTATGG + Intergenic
940621347 2:156117828-156117850 CCTTAGAGTCAAGAATTTTGGGG - Intergenic
940704517 2:157087091-157087113 CTTTAAAACAAAGATTTTTAGGG - Intergenic
940754708 2:157668994-157669016 CCCTACAACCAACAATCTTGAGG + Intergenic
941181454 2:162264232-162264254 CCTTAGAGAAAAGAATTCTGGGG - Intergenic
941183622 2:162292427-162292449 CCTTAGAACAAATTAGTTTGAGG - Intronic
941770657 2:169341953-169341975 CCATACTACAAAGAATTGTCTGG - Intronic
942089699 2:172478004-172478026 ACATACAACACACAATTTTGAGG - Intronic
942749902 2:179275889-179275911 ACTTACAACAGTCAATTTTGAGG - Intergenic
943745948 2:191463090-191463112 CCCTACAACAAAGGATTATCTGG + Intergenic
943780621 2:191819571-191819593 CCTTTTAACAAAGCCTTTTGTGG + Intergenic
944342712 2:198622118-198622140 CCCCACAGCAAAGAATTATGTGG + Intergenic
944513293 2:200485362-200485384 CCTAACAATAAAGAATTATTTGG + Intergenic
946540371 2:220677508-220677530 CCCTACAAGAAAGAATTATCTGG + Intergenic
946898526 2:224349339-224349361 CCCTGCAACAAAGAATTATTTGG + Intergenic
947868412 2:233417933-233417955 CCTCACAACAAAGAATTATTTGG + Intronic
1169583462 20:7053064-7053086 CCCTACCACAAAGAAATTTCAGG - Intergenic
1169886521 20:10404478-10404500 CCGTACAACAAAGAATTATGGGG + Exonic
1169977582 20:11347501-11347523 CCTCACAACCAAGAATTATCTGG - Intergenic
1170200311 20:13736175-13736197 CGTCACAACAAAGAATTATCTGG - Intronic
1170584175 20:17721908-17721930 CCCCACAACAAAGAATTATCTGG - Intronic
1172150881 20:32789581-32789603 TCTTTCAACAAAGATTTTTTTGG + Intronic
1173094616 20:40013183-40013205 TCTTACAACAAAGAATTATCTGG + Intergenic
1174120768 20:48263628-48263650 CCCTACGACAAAGAATTATCTGG + Intergenic
1174548242 20:51342555-51342577 CCCCACAACAAAGAATTATCTGG + Intergenic
1174671708 20:52314090-52314112 CCCCACAACAAAGAATTATTCGG + Intergenic
1174715187 20:52750233-52750255 CTTCACAACAAAGAATTATCTGG + Intergenic
1174750046 20:53102829-53102851 CATTAGTACAATGAATTTTGTGG + Intronic
1174781137 20:53389849-53389871 CCCGACAACAAAGAATTGTCCGG + Intronic
1175052443 20:56167773-56167795 CCCCACAACAAAGAATTATTTGG + Intergenic
1175613330 20:60370514-60370536 CCTCACAACAAAGAATAATCTGG + Intergenic
1176661005 21:9634910-9634932 CCCAACAACAAAGAATTGTGTGG - Intergenic
1176997568 21:15574548-15574570 CCTTATAACAAAGAATTATCTGG - Intergenic
1177126211 21:17195934-17195956 ACTTGAAACAAAGAATTTTGAGG - Intergenic
1177190329 21:17844539-17844561 CCCCACAACAAGGAATTATGTGG - Intergenic
1177291861 21:19123013-19123035 CCTTACTAAATTGAATTTTGTGG + Intergenic
1177348805 21:19907985-19908007 CCCTAGAATACAGAATTTTGGGG + Intergenic
1177506335 21:22023534-22023556 CCTTAGAACCTAGAACTTTGAGG + Intergenic
1177790134 21:25713996-25714018 CCTTACACCAAAGAATGATGTGG - Intronic
1178292907 21:31384965-31384987 CATTTCAACAAAGGATTTAGAGG - Intronic
1179241733 21:39598767-39598789 CCTTATAAAAAGGAAGTTTGAGG - Intronic
1180555663 22:16569716-16569738 TCCTACAACAAAGAATTATTTGG - Intergenic
1181446787 22:22982817-22982839 CCTCACAACAAGGAATTATTTGG - Intergenic
1182649101 22:31836261-31836283 CCCCACAACAAAGAATTATCTGG + Intronic
1182720248 22:32392521-32392543 CCTCCCAACAAAGAATTCTCCGG - Intronic
1184295913 22:43525403-43525425 GCTTTCAACAAAAAATTTTGAGG - Intergenic
1185301189 22:50081965-50081987 CCTTAGAACAAAGCCCTTTGGGG - Intronic
949118028 3:352593-352615 CCTTAAAACCAAAAATTCTGAGG - Intronic
949263908 3:2135023-2135045 CCTTACAACAAAGAGTTATCAGG + Intronic
949864434 3:8535845-8535867 TCCAACAACAAAGAATTATGAGG - Intronic
950792964 3:15487954-15487976 CCCTACAATACTGAATTTTGGGG - Intronic
951230835 3:20177612-20177634 CTCTACAACAAAGAATTATCTGG + Intronic
951580702 3:24159840-24159862 CATCACAACAAAGAATTATATGG + Intronic
951624984 3:24649906-24649928 CCCCACAACAAAGAATTGTCTGG + Intergenic
951834816 3:26971339-26971361 CCTTAAAACAAAGAAGTATGTGG - Intergenic
951936592 3:28029393-28029415 CCTCACAACCAAGAATTATTGGG + Intergenic
952027804 3:29104277-29104299 CAGTAAAACAAAGTATTTTGTGG - Intergenic
952434267 3:33256742-33256764 GGTTTCAACAGAGAATTTTGGGG - Intergenic
952951107 3:38526225-38526247 TATTACAAGAAAGATTTTTGTGG + Intronic
953243930 3:41173980-41174002 CCAAACAACAAAGAAGTATGTGG + Intergenic
954198393 3:49009499-49009521 CATTCCAACAAAGAATTATCTGG - Intronic
954571211 3:51642545-51642567 CCTTATAACAAAGAATTATCTGG - Intronic
954804489 3:53209157-53209179 TCTTAAAACACTGAATTTTGGGG - Intergenic
954998640 3:54905756-54905778 CTCCACAACAAAGAATTATGTGG + Intronic
955016901 3:55079239-55079261 CCCGACAACAAAGAATTGTTTGG + Intergenic
955103827 3:55877139-55877161 CCCAACAACAAAGAATTTTCTGG - Intronic
955144357 3:56301382-56301404 TCCTACAAAAAAGATTTTTGAGG + Intronic
955401807 3:58597310-58597332 CTTTACAACATAGATTTTTGGGG + Intronic
955443183 3:58978748-58978770 CATTAAAACAAAGAAATATGAGG + Intronic
955596790 3:60599876-60599898 CTTCACAGCAAAGAATTATGTGG - Intronic
955722234 3:61894942-61894964 TCCTACAACAAAGACTTATGGGG - Intronic
955986870 3:64582715-64582737 CCCTACAACAAAAAATTATCTGG + Intronic
956089641 3:65652385-65652407 CCCAACAACAAAGAATTATCTGG - Intronic
956228177 3:66983130-66983152 CCCCACAACAAAGAATTATCTGG - Intergenic
956644318 3:71441371-71441393 CCCCACAACAAAGAACTTTCTGG + Intronic
956680511 3:71775100-71775122 CCCTACGACAAAGAATTATCTGG + Intronic
956949462 3:74264586-74264608 GATTTCAACAAAGAATTTGGGGG - Intronic
957861862 3:85962960-85962982 CCTTTCCAAAAAGAAATTTGGGG + Intronic
958027274 3:88063203-88063225 TCTAACAACAAAGAATTATCTGG + Intronic
958041208 3:88228922-88228944 CCTCACAACAAAGAGTTGTCTGG + Intergenic
958819860 3:98960900-98960922 CCTCACAACAAGGAATTATCTGG + Intergenic
959136037 3:102422414-102422436 TCCTACAACAAAGAATTATCTGG + Intronic
959896241 3:111609990-111610012 CCTCACAACAAAGAATTATTTGG + Intronic
960086300 3:113595169-113595191 CCCAACAACAAAGAATTATCTGG - Intronic
960466318 3:118000141-118000163 CCATACAACAAAGAATTATCTGG - Intergenic
960704822 3:120471945-120471967 CTCTACAACAAAGAATTATCTGG - Intergenic
962100993 3:132342459-132342481 CCCTACAACAAACAATTGTCTGG + Intronic
963472918 3:145766032-145766054 ATTTACAACAAAGAAGTTAGAGG - Intergenic
963614034 3:147511889-147511911 CTTCACAACAAAGAATTATCTGG - Intergenic
963631141 3:147731619-147731641 CCAGTCAACATAGAATTTTGTGG + Intergenic
963822053 3:149908345-149908367 AGTTAGAACAAAGAATATTGAGG + Intronic
963872755 3:150436228-150436250 ACTTACAAAAAAAAATTTTAAGG - Intronic
964156803 3:153595455-153595477 CCTGACAACAAAGAATTATCTGG + Intergenic
964221040 3:154345122-154345144 CCATTCAACAAATATTTTTGAGG - Intronic
964380189 3:156090878-156090900 CCTCACAACAAAGAATTAACTGG + Intronic
965096822 3:164239957-164239979 CCTCACAATAAAGAATTATCTGG + Intergenic
965330269 3:167364099-167364121 CCCCACAACAAAGAATTATTCGG - Intronic
965570815 3:170170426-170170448 CCTGACAACAAAGAATTATCTGG + Intronic
965622125 3:170652315-170652337 CCCTACAACAAAGAATTATCTGG - Intronic
965666940 3:171105279-171105301 CCCTACAATAAAGAATTATCTGG - Intronic
966049543 3:175597610-175597632 CCCTACAACAAAGAATTACTTGG - Intronic
966368319 3:179215905-179215927 TCCTACAACAAAGAATTATTTGG - Intronic
966570328 3:181434788-181434810 CCTCACAACAAAGACTTATCTGG - Intergenic
966699686 3:182833956-182833978 GCTTACAACAAAGCATCTTCTGG - Intronic
966708681 3:182947984-182948006 CCCTACAACAAATAATTATCTGG - Intronic
966830201 3:184001635-184001657 CCCCACAACAAAGAATTATGTGG + Intronic
967574150 3:191070692-191070714 CCTCACAACAAATAATTATCTGG - Intergenic
969120978 4:4910969-4910991 CCTTATAAAAAAGAAATATGAGG - Intergenic
969893762 4:10283533-10283555 CCTTACAACAGAGAACTCTTTGG + Intergenic
970550384 4:17174457-17174479 CCTTACTACAAAGAATGTAAGGG + Intergenic
972098855 4:35385868-35385890 ACAGACAAAAAAGAATTTTGTGG - Intergenic
973019262 4:45180006-45180028 CCTTACAAGCTAGAAATTTGGGG + Intergenic
973122519 4:46540098-46540120 CCTTCCCACAAATAAGTTTGAGG + Intergenic
973297733 4:48544236-48544258 CCTTCCAGCAAAGAATTTTCTGG - Intronic
973659773 4:53092326-53092348 CATTTCAACTAACAATTTTGAGG - Intronic
974658058 4:64850247-64850269 CCACACAACAAAGAATTATTTGG - Intergenic
974685164 4:65217525-65217547 CCTTGCAACAAAGAGTTTATAGG + Intergenic
974941584 4:68475819-68475841 CCCTACAACAAAGAATTAAATGG + Intronic
975302642 4:72808426-72808448 CATTCCAACAAAGAGTTTTAAGG + Intergenic
975336517 4:73182812-73182834 CCAAACAACAAAGAATTATCTGG - Intronic
975420228 4:74155801-74155823 CCTTACCACAAATAATTTTCAGG + Intronic
975599325 4:76082904-76082926 CCACACAACAAAGAATTATATGG + Intronic
976382534 4:84416133-84416155 CCCTACAACAAAGGATTATCTGG + Intergenic
977212080 4:94230532-94230554 CCTCACAACAAAGAATTATCTGG - Intronic
977359840 4:95988216-95988238 CCTTACACCTGAGAAATTTGTGG + Intergenic
978232918 4:106422845-106422867 CCCCACAACAAAGAATTATTTGG - Intergenic
979201965 4:117989171-117989193 GTTTACAACAAAGGAATTTGGGG + Intergenic
979371832 4:119897650-119897672 CCTAACAACAAAAAATTGTAAGG + Intergenic
979438111 4:120719113-120719135 CCTCACACCAAAGAATTATCTGG - Intronic
979572427 4:122243745-122243767 CATTACAACTAAAAATTTTATGG - Intronic
979601319 4:122589285-122589307 CCTTACAACAAATAGTTATCTGG + Intergenic
980693897 4:136330798-136330820 CCTTACAAGACAGAAATTGGTGG + Intergenic
980772634 4:137396607-137396629 CCTCATAACAAAGAATTATCTGG - Intergenic
981397876 4:144275410-144275432 CTTCACAACAAAGAATTATCTGG + Intergenic
981834601 4:149040519-149040541 CCTTACAAAATAGATTTGTGAGG + Intergenic
982233817 4:153233525-153233547 CTCAGCAACAAAGAATTTTGGGG - Intronic
983193638 4:164781557-164781579 CCCTACAACAAAGAATGATCTGG - Intergenic
983403228 4:167292170-167292192 CCCAATAACAAAGAATTTTCTGG + Intergenic
984011042 4:174372168-174372190 CCTCAAAAAAAAAAATTTTGAGG + Intergenic
984168812 4:176336412-176336434 CCTTAGAACTTAGAATATTGGGG - Intergenic
985414392 4:189721626-189721648 CCCAACAACAAAGAATTGTGTGG + Intergenic
986308604 5:6533960-6533982 TCTTGCAAGAAAGAATTTGGTGG - Intergenic
986440126 5:7773691-7773713 CCACAGAACAAAGAATTTTCAGG - Intronic
986732183 5:10643240-10643262 CCCCACAACAAAGAATTATCTGG - Intronic
988098091 5:26643316-26643338 CTTACCAATAAAGAATTTTGGGG - Intergenic
988414730 5:30931707-30931729 CCTCACAACAAAGAATTATCTGG - Intergenic
988557812 5:32253205-32253227 CCCCACAACAAAGAATTATCTGG + Intronic
988639411 5:33024906-33024928 CCCCACAACAAAGAATTATTTGG + Intergenic
988945373 5:36191321-36191343 CCCTACAACAAAGAATTGTCTGG + Intergenic
989458680 5:41671024-41671046 CCTGACAACAAGGAATTATCAGG - Intergenic
989488675 5:42023887-42023909 CCTTGCAACAAAGAAAACTGTGG + Intergenic
989761421 5:45021034-45021056 CCCAACAACAAAGAATTATCTGG - Intergenic
989791066 5:45402481-45402503 CCTCACAACAAAAAATTGGGAGG + Intronic
990339077 5:54804669-54804691 TCTCACAACAAAGAATTATCAGG - Intergenic
990419999 5:55622328-55622350 CCTTACATCAAAGCATTTTTTGG + Intergenic
990449462 5:55921018-55921040 CCTCACAACAAAGAATTATCTGG + Intronic
991197123 5:63948228-63948250 CCCTACAACAAATAATTATCTGG - Intergenic
991530096 5:67605289-67605311 CCCCACAACAAAGAATTGTCTGG + Intergenic
992588125 5:78262461-78262483 CTTTTCAACAAATAATGTTGGGG - Intronic
992791252 5:80216193-80216215 CCCGACAAGAAAGAATTTTCTGG - Intronic
993302673 5:86231004-86231026 CCTTACAAAAAAGAATTCAATGG + Intergenic
993811917 5:92490669-92490691 CCCCACAACAAAGAATTATCCGG - Intergenic
994064603 5:95523962-95523984 TCTTACATCAAAGGATTTTTTGG - Intronic
994768226 5:103949752-103949774 ACTTTGAACAAAGAGTTTTGTGG + Intergenic
995130049 5:108620556-108620578 CCTTAGAAGAAAGAATTTGACGG + Intergenic
995732075 5:115256247-115256269 CCATACAACCAAGAATTATCTGG + Intronic
995956743 5:117785715-117785737 CCCAACAACAAAGAATTATCAGG - Intergenic
997663000 5:135603718-135603740 CCTTTCAACAAATAAGTCTGGGG - Intergenic
997783113 5:136679742-136679764 CCTCCCAACAAAGAATTATCTGG - Intergenic
997832465 5:137162652-137162674 CCCTACAACAAAGAATTATGTGG + Intronic
998833172 5:146180858-146180880 CCTGAAAACAAAGAATTATTTGG - Intronic
999621355 5:153477891-153477913 CCCCACAACAAAGAATCTTCTGG - Intergenic
999626408 5:153525353-153525375 CCCTACAACAAATAATTATCTGG + Intronic
999862499 5:155663516-155663538 CCTCACAACAAAGAATTATTTGG + Intergenic
999948772 5:156626122-156626144 CCCTACAACAAAGAATGATCTGG + Intronic
1000090724 5:157927703-157927725 CCTCACAGCAAAGAATTATCTGG - Intergenic
1003055139 6:2811337-2811359 CCCCACAACAAAGAATTATCCGG - Intergenic
1003274835 6:4640720-4640742 CTTCACAACAAAGAATTGTCTGG - Intergenic
1004349811 6:14881113-14881135 CCTTACAACAAAGGACTGTAAGG + Intergenic
1004408190 6:15354785-15354807 CCCTACAAGCAAGAATTGTGTGG + Intronic
1004854688 6:19737185-19737207 CCTTCTATAAAAGAATTTTGGGG - Intergenic
1005299631 6:24457972-24457994 CCGTACACCACAGAATTTGGGGG + Intronic
1005312682 6:24573559-24573581 CCACACAAAAAAGAAATTTGTGG + Intronic
1005641896 6:27804097-27804119 ACTTACAACAAACTATTTGGTGG - Intergenic
1005673826 6:28134119-28134141 CCCTACATCAAAGAATTGTCTGG - Intergenic
1006432364 6:34005416-34005438 CCTCACAACAAAGAATAATCAGG + Intergenic
1006664894 6:35686042-35686064 CATTAAAACAACTAATTTTGAGG - Intronic
1006705031 6:36012508-36012530 CCCAACAACAAAGAATTATCTGG - Intronic
1007164108 6:39816394-39816416 CCCCACAACCAAGAATTATGTGG - Intronic
1007488518 6:42199383-42199405 CCTTACAACAAAGCCCCTTGTGG + Intergenic
1007536432 6:42594638-42594660 TATTATAACAAAGACTTTTGGGG + Intronic
1008289819 6:49701132-49701154 CTTTTCAAAAAATAATTTTGGGG + Intronic
1008355375 6:50546713-50546735 AAATACAATAAAGAATTTTGAGG - Intergenic
1008606665 6:53146685-53146707 CCCCACAACAAAGAATTATCTGG - Intronic
1008618233 6:53246713-53246735 CCACACAACAAATAATTATGTGG - Intergenic
1009032711 6:58080143-58080165 ACTTAGAACAATGAAATTTGTGG - Intergenic
1009208323 6:60831911-60831933 GCTTAGAACAATGAAATTTGTGG - Intergenic
1009477167 6:64107717-64107739 CCTTTCAACAAAAAAATATGAGG - Intronic
1009653394 6:66506403-66506425 CCCCACAACAAAGAATTATCTGG - Intergenic
1010152773 6:72754604-72754626 CCACACAACAAAGAATTATCAGG + Intronic
1010562439 6:77367361-77367383 CCCTACAACAAAGAATTATATGG - Intergenic
1011117508 6:83909908-83909930 CCCCACAACAAAGGATTTTCTGG + Intronic
1011254748 6:85408775-85408797 CCTTAGAAAAAATAATTTTCAGG + Intergenic
1011937622 6:92800546-92800568 CATTACAGCAAGGAATTTTGAGG + Intergenic
1011996884 6:93601326-93601348 CATTACATAAAAGATTTTTGAGG - Intergenic
1012331211 6:97990179-97990201 CCCTACAACAAAGAATTATCTGG + Intergenic
1012361403 6:98385701-98385723 CCTTATAACAAAGATTTATTTGG - Intergenic
1012601579 6:101104616-101104638 CCTACCAACAAAAAATTTTCTGG + Intergenic
1013893834 6:115060600-115060622 CCTCACAACAAATAACTATGTGG - Intergenic
1014048939 6:116928704-116928726 ACTTACTACAAAGAACTTTCAGG - Intronic
1014518474 6:122408116-122408138 GGTTTCAACATAGAATTTTGGGG + Intronic
1014908610 6:127061618-127061640 CCCTACAACAAAGAATTATTTGG - Intergenic
1015444423 6:133286883-133286905 CAACACTACAAAGAATTTTGTGG - Intronic
1015494770 6:133869097-133869119 GGTTTCAACTAAGAATTTTGGGG - Intergenic
1016656543 6:146524750-146524772 CCATACAACAAGGAATTATCTGG + Intergenic
1016897721 6:149069958-149069980 CCTTACGACAAAGAGCTTTGAGG + Intronic
1017256597 6:152340419-152340441 CCCCACAACAAAGAATTATTTGG - Intronic
1018239812 6:161762277-161762299 CCTGACAATGAGGAATTTTGAGG + Intronic
1018777483 6:167030992-167031014 CCATAAAACAATGAATTTGGGGG - Intronic
1019538947 7:1543014-1543036 CTTTGCAATAAAGAATTTTCTGG + Exonic
1020960072 7:14791177-14791199 ACTTACATCTAAGTATTTTGGGG + Intronic
1021234005 7:18120258-18120280 CCCCACAACAAAGAATTATGTGG + Intronic
1021248632 7:18295888-18295910 CCCCACAACAAAGAATTATTTGG + Intronic
1021568084 7:22034300-22034322 CCTTAGGACAAACAAGTTTGGGG - Intergenic
1021829352 7:24588092-24588114 CCCCACAACAAAGAATTATCTGG + Intronic
1021882551 7:25108686-25108708 CCCCACAACAAAGAATTATCTGG - Intergenic
1022054873 7:26719966-26719988 CCCCACAACAAAGAATTGTCTGG - Intronic
1023507149 7:40911611-40911633 CCCCACAACAAAGAATTATCTGG - Intergenic
1024383694 7:48726800-48726822 ACTGACAAAAAAGACTTTTGTGG + Intergenic
1024753930 7:52505524-52505546 CCTTTGAAAAAAGAATATTGAGG + Intergenic
1024815673 7:53267741-53267763 CTTAACAACAAATAATGTTGAGG + Intergenic
1025765093 7:64437564-64437586 CCTTACAACAAAGAAAACTTTGG - Intergenic
1026525304 7:71148068-71148090 CATGACAACAAATCATTTTGAGG - Intronic
1026564251 7:71476755-71476777 TCTTACAACAAAGAATTATCTGG + Intronic
1027568307 7:79827618-79827640 CCTCACAAAAAACATTTTTGTGG + Intergenic
1027679352 7:81200334-81200356 CATTACAACAAAGCATATAGAGG - Intergenic
1029587140 7:101481893-101481915 CCTTTCTACAAAGAATTATCGGG + Intronic
1029946668 7:104540466-104540488 CCCCACAACAAAGAATTATCTGG + Intronic
1030474003 7:110005028-110005050 GCTTAAAACACAGATTTTTGTGG - Intergenic
1030684813 7:112474497-112474519 CCGTACAAGAAACAATTATGTGG - Intronic
1030880166 7:114867999-114868021 CCTTATTACAAAAGATTTTGGGG + Intergenic
1031482384 7:122294293-122294315 CCATAAAATAAAGAATTTTCTGG - Intergenic
1032238617 7:130144194-130144216 CCCCACACCAAAGACTTTTGGGG + Intergenic
1033029990 7:137816884-137816906 CCTCACAACAAAGAACTCTCTGG - Intronic
1033232556 7:139612845-139612867 TTTTACAAGAAAGAAATTTGAGG + Intronic
1033342958 7:140506260-140506282 CCTTAAAAGAAAGAAAATTGGGG - Intergenic
1034085736 7:148320678-148320700 CCAGCCAACAAAGAATTTTTAGG + Intronic
1034149619 7:148904152-148904174 TTTTCCAACAAGGAATTTTGGGG + Intergenic
1034151173 7:148916592-148916614 CCCCACAACAAAGAATTATTGGG - Intergenic
1034587671 7:152109948-152109970 CCCTACAACAAAGAATTATCTGG - Intronic
1034605825 7:152313521-152313543 TTTTATAACTAAGAATTTTGTGG - Intronic
1035405754 7:158596058-158596080 CCTTCCAATAAAGTCTTTTGTGG + Intergenic
1036501984 8:9322479-9322501 CCCTTCTACAAAGATTTTTGAGG + Intergenic
1037774013 8:21820790-21820812 CCTTAAAAAAAAGAAATCTGGGG - Intergenic
1039917113 8:41868242-41868264 CCCTACAGCAAGGAATTATGTGG - Intronic
1040929754 8:52721345-52721367 CCTTATAACAAAGAATTAACTGG - Intronic
1041237854 8:55822691-55822713 CCTTACAAAAAAAAATAGTGGGG + Intronic
1041466787 8:58165267-58165289 TCTTTCAAAAAAGAATTTTAAGG - Intronic
1041800892 8:61797369-61797391 GCTTTAAACAAAGAATTATGAGG - Intergenic
1042477398 8:69264417-69264439 CCCAACAACAAAGAATTATCTGG - Intergenic
1042571719 8:70172300-70172322 ACATACAACAATGAATTTGGTGG + Intronic
1042806068 8:72772287-72772309 CCCCACAACAAAGAATTATCTGG - Intronic
1042967325 8:74368783-74368805 CCACACAACAAAGAATTATCTGG - Intronic
1043960066 8:86407401-86407423 CCCTACAACAAAGAATTACCTGG - Intronic
1045403397 8:101841418-101841440 CCCTACAACAAAGAAGTATCTGG - Intronic
1045458677 8:102407890-102407912 CCCCACAACAAAGAATTACGGGG - Intronic
1045941399 8:107742987-107743009 CCTTAAAACACAGAGTTATGGGG + Intergenic
1046617029 8:116489149-116489171 CCTCACAACAAAGAATTATCTGG - Intergenic
1046747326 8:117890433-117890455 CCCCACAACAAAGAATTTTCTGG + Intronic
1047014092 8:120703922-120703944 CCTTATAAGAAAGAAAATTGTGG + Intronic
1047127494 8:121978361-121978383 TTTTACAACAGAGAAATTTGAGG + Intergenic
1047215978 8:122876245-122876267 CCTGGCAACAATGAATTTGGAGG - Intronic
1047449520 8:124952430-124952452 CCCTACAACAAAGAAGTATCTGG - Intergenic
1047702684 8:127465443-127465465 CCTCACAACAAAGAATTATCTGG + Intergenic
1047737377 8:127777803-127777825 TCTCATAACAAAGAATTTTCTGG - Intergenic
1047864304 8:129004898-129004920 CTATACTACAAAGAATTTAGAGG - Intergenic
1048077065 8:131083139-131083161 CCTTAGAAAAAATAATTTTGGGG - Intergenic
1048717945 8:137288533-137288555 CCTTATAAATAAGAACTTTGGGG - Intergenic
1049133428 8:140871031-140871053 CCCTACAACAAAGAATTATTTGG + Intronic
1052033584 9:23656030-23656052 CCTGACAACAAAGAATAGTTTGG + Intergenic
1052571914 9:30236724-30236746 TCTTATAAAAAAGTATTTTGGGG + Intergenic
1052832103 9:33224015-33224037 CCTTACAACAAAGAATTATTAGG + Intronic
1053256667 9:36623063-36623085 CCCTACAACAAAGAATTATGTGG - Intronic
1054735924 9:68749725-68749747 CCCCACAACAAAGAATGTTCTGG - Intronic
1055024151 9:71701405-71701427 TCTTAAAACTAAGAATTTTTAGG - Intronic
1055206222 9:73733846-73733868 GCTTAGAGGAAAGAATTTTGTGG + Intergenic
1055650485 9:78402199-78402221 CCTCACAACAAAGAATTATCTGG + Intergenic
1055654251 9:78437554-78437576 CCTCACCACAAAGAATTGTCTGG - Intergenic
1056458461 9:86786236-86786258 CCTTACGAGAAAGGATTTTAGGG - Intergenic
1057724450 9:97558333-97558355 CCATACAGCAAAGACTCTTGTGG - Intronic
1058060756 9:100493210-100493232 CCCTACAACAAAGAATTATCTGG + Intronic
1058358891 9:104118397-104118419 ATTTACCACAAAGAATTGTGAGG - Intronic
1058953035 9:109921324-109921346 CCCTACAGCAAAGAATTTTCTGG - Intronic
1059508624 9:114823104-114823126 CCCCACAACAAAGAATTATCTGG - Intergenic
1059830498 9:118090163-118090185 TCCTTCAACAAAGAATTTTCTGG + Intergenic
1060016313 9:120089403-120089425 CCCCACAACAAAGAATTTTATGG + Intergenic
1060768197 9:126310660-126310682 CCTTATAACAACCTATTTTGGGG - Intergenic
1203638573 Un_KI270750v1:136754-136776 CCCAACAACAAAGAATTGTGTGG - Intergenic
1186100775 X:6154067-6154089 CCCCACAACAAAGAATTATATGG - Intronic
1186630542 X:11344165-11344187 CCCTACAACATAGAATTATCTGG - Intronic
1187796008 X:23005300-23005322 CCTCACAACAAAGAATTATCTGG + Intergenic
1187796372 X:23008004-23008026 CCCTAAAACAAAGAATTATCTGG + Intergenic
1187935638 X:24333081-24333103 CCTAACAACAAAGAATTATCTGG + Intergenic
1187971582 X:24664182-24664204 CCCTACAACAAAGAATTATCTGG + Intronic
1187978711 X:24731699-24731721 CCCCACAACAAAGAATTATTTGG + Intronic
1188569869 X:31571712-31571734 CCCCACAACAAAGAATTATTTGG - Intronic
1188784806 X:34332583-34332605 CCTCACAGCAAAGAATTATCTGG + Intergenic
1189505644 X:41611148-41611170 CCCCACAACAAAGAATTATCTGG + Intronic
1189666697 X:43363139-43363161 CATTAAAACAAAGAGTTATGTGG - Intergenic
1192258781 X:69490313-69490335 CCACACAACAAAGAATTATCTGG + Intergenic
1193134862 X:77959459-77959481 CCTCACAACAAAGAATGATCTGG - Intronic
1193276698 X:79597104-79597126 CTTTAAAACAACTAATTTTGTGG + Intergenic
1194565554 X:95483812-95483834 TCTAACAATAAAGAATTTTCTGG + Intergenic
1196055670 X:111352201-111352223 CCCTACAACAAAGAATTATCTGG + Intronic
1197380242 X:125729885-125729907 CCTTACAAAACAGATTTGTGAGG - Intergenic
1198650999 X:138863952-138863974 CTTCACAACAAAGAATTATCAGG - Intronic
1198675089 X:139122903-139122925 TCTCACAACAAAGAATTATGTGG - Intronic
1199217557 X:145277919-145277941 GCTTTCAACAAAAAATTTTGAGG - Intergenic
1199239584 X:145530565-145530587 CTTTTCAACAAATAATGTTGAGG - Intergenic
1199453736 X:148003511-148003533 ATTTACCACAAAGAATTATGAGG + Intronic