ID: 1089479119

View in Genome Browser
Species Human (GRCh38)
Location 11:118791071-118791093
Sequence GGCTGGACAGCCGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089479119_1089479128 5 Left 1089479119 11:118791071-118791093 CCGGCTCCCCCGGCTGTCCAGCC 0: 1
1: 0
2: 0
3: 43
4: 365
Right 1089479128 11:118791099-118791121 TCCTCCGCTGCCCGCTCTCGTGG 0: 1
1: 0
2: 0
3: 14
4: 103
1089479119_1089479133 27 Left 1089479119 11:118791071-118791093 CCGGCTCCCCCGGCTGTCCAGCC 0: 1
1: 0
2: 0
3: 43
4: 365
Right 1089479133 11:118791121-118791143 GCGCCGCCGAAGTCGCCGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089479119 Original CRISPR GGCTGGACAGCCGGGGGAGC CGG (reversed) Intronic
900116907 1:1032943-1032965 CGCTGCCCAGCCGGGGGATCCGG - Intronic
900216803 1:1486094-1486116 GGCTGGGCTGCCGGGGAAGACGG - Exonic
900223888 1:1523823-1523845 GGCTGGGCTGCCGGGGAAGACGG - Exonic
900482601 1:2906422-2906444 CTCTGGACAGCAGGGGGATCAGG + Intergenic
900573903 1:3373635-3373657 GGCAGGACAGACGCGGGACCTGG + Intronic
900591669 1:3463001-3463023 GGGTGGACACCCGCGGGGGCAGG + Intronic
900594172 1:3472880-3472902 TGCTGGACAGCAGGGAGGGCGGG - Intronic
900810054 1:4795028-4795050 GGCTGGGCATCAGGAGGAGCTGG + Intergenic
900920203 1:5665281-5665303 CGCAGGACAGCCTGGGGATCTGG + Intergenic
900931868 1:5742964-5742986 GGCTGCACAGCCAGGGGCGCTGG - Intergenic
900950080 1:5853628-5853650 TGCTGGACAGGCTGGAGAGCTGG - Intergenic
901929220 1:12586111-12586133 GGCAGGACAGCCCGGGGCCCCGG - Intronic
903778744 1:25808879-25808901 GGCAGGAGAGCAGGTGGAGCAGG - Intronic
903954739 1:27017535-27017557 GCCTGGACAGCCAGGGCAACAGG + Intergenic
904379049 1:30099009-30099031 GGCTGGAATGCTGAGGGAGCTGG + Intergenic
904782978 1:32964498-32964520 GGCTGCGCAGCCGGGGGCGGCGG + Exonic
905168881 1:36098627-36098649 GGATGGGGAGCCAGGGGAGCAGG - Exonic
905235630 1:36544551-36544573 TGCTGGAGACCCCGGGGAGCTGG + Intergenic
905308651 1:37034983-37035005 GGCTGGACGGCGGTGGCAGCGGG + Intergenic
905356674 1:37389761-37389783 TGCTCCACAGCCGTGGGAGCAGG - Intergenic
905786895 1:40765595-40765617 GGCTGGGCAGCCAGGGCAGGTGG + Intronic
906214565 1:44031253-44031275 GGCAGGACAGACGGAGGCGCGGG + Intronic
908172454 1:61519644-61519666 GGCTGGAGAGGCGGGGAAGGGGG - Intergenic
908184738 1:61641888-61641910 GGCTTCTCAGCCGGGGGATCTGG + Intergenic
909564983 1:77044183-77044205 GGCTGGAAGGCAGGGGGAGAAGG - Exonic
911725619 1:101238410-101238432 GGCTGGAAATCCGGGGGTGAGGG + Intronic
912435975 1:109661298-109661320 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912437917 1:109674880-109674902 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912440428 1:109693339-109693361 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
913214579 1:116609880-116609902 GGCTGGAGAGCCTGAGGAGCGGG - Intronic
914448645 1:147771815-147771837 GGAGGGACAGCCAGGGGAGCAGG + Intronic
915213411 1:154325783-154325805 GGCTGGAGGGGCCGGGGAGCGGG + Intronic
915361340 1:155288033-155288055 GGCTGGAGAGTCAGGGGAGAGGG - Exonic
916077412 1:161209944-161209966 GGCTGGACATTTGGGGAAGCCGG - Intronic
916647181 1:166797505-166797527 GTCTGGGCAGCGAGGGGAGCCGG + Intergenic
919098014 1:193059919-193059941 GGGTGGACAGGCGCGGAAGCGGG - Intronic
919810377 1:201405521-201405543 GGCTGGGCAGCCGGGGGCGGGGG - Exonic
919974238 1:202600462-202600484 CCCTGGACAGCCGGAGAAGCTGG - Exonic
921383844 1:214551035-214551057 GGCAGGGCAGCCTGGGGCGCGGG - Intronic
922467512 1:225854262-225854284 GGCTGGACAGCAGTGGGCGAGGG + Intronic
923673898 1:236064519-236064541 GACTGGACAGCCGAGGGACGCGG + Intronic
1062889625 10:1048724-1048746 GCCTGGACAGCTGGGGGTGGCGG - Intronic
1063448636 10:6136296-6136318 GGCAGGTCAGCCCGGGGTGCAGG - Intergenic
1065824346 10:29556290-29556312 GGCTGGACAGCCTGGGGCCAGGG + Intronic
1067084231 10:43229663-43229685 GGCAGGACGGCGCGGGGAGCCGG - Exonic
1067937649 10:50624758-50624780 GGATGGACAGCGGGGAGAGCTGG + Intronic
1069934242 10:71904491-71904513 GGCTGGGGAGCCTGGGGAGCAGG - Intergenic
1072611701 10:97021358-97021380 AGCTGGACAGCCAGCGGAGGTGG + Exonic
1073063279 10:100744737-100744759 GGCGGGAGAGCCGGGGGACTTGG - Intronic
1073615457 10:104990582-104990604 AGGTGGACAGCCTGGGGAGTTGG - Intronic
1075778262 10:125001731-125001753 GGCTGGGGAGCCGGGCGAGCAGG - Intronic
1076039291 10:127229386-127229408 GACTGGAGAGCGGGGGGACCGGG - Intronic
1076474740 10:130744112-130744134 GGCTGGGCTGCCGGGGCCGCAGG + Intergenic
1076479425 10:130775159-130775181 GTCTGGAGGGCCTGGGGAGCAGG - Intergenic
1076721042 10:132393366-132393388 GCCTGGACAGACTAGGGAGCAGG - Intergenic
1076757399 10:132579638-132579660 GGCAGGATGGCCGGGGAAGCAGG - Intronic
1076807829 10:132867944-132867966 GGCGGGACAGCCGGGGGCCGTGG - Intronic
1076825968 10:132968433-132968455 GGCTGGAGAACAGGGAGAGCTGG - Intergenic
1077023465 11:429891-429913 GGCAGGAAAGCCGGGGAAGGGGG + Intronic
1077025920 11:439832-439854 GACTGGACAGCTGGAGGGGCCGG - Intronic
1077535482 11:3122149-3122171 GGCTGGACGGTGGGAGGAGCTGG - Intronic
1078088228 11:8247477-8247499 TCCTGGCCAGCAGGGGGAGCTGG + Intronic
1078382752 11:10858743-10858765 GGCTGGGGAGCCGCGGGAACAGG + Intronic
1080765780 11:35295626-35295648 GGCTGGAGAGCCTGGGGAGAGGG + Intronic
1083000388 11:59285734-59285756 GGCTGGGCAGTCAGGAGAGCAGG + Intergenic
1083191124 11:61052998-61053020 GGCTGGAGACCTGGGGCAGCAGG + Intergenic
1083272168 11:61578077-61578099 GGCTGGACAGAGTGTGGAGCTGG + Intronic
1083615221 11:64022776-64022798 GGCTGGGGAGCCAGGGGAGCAGG + Intronic
1084627906 11:70323092-70323114 GGCTAGTCAGCAGGGAGAGCTGG - Intronic
1084656469 11:70522645-70522667 GGCCGGCCAGCCCGCGGAGCTGG - Intronic
1088788276 11:113201879-113201901 GTCCGGACAGCCTGGGGAACTGG + Intronic
1089129801 11:116202817-116202839 GGTTGGACAGGGAGGGGAGCAGG - Intergenic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1089603869 11:119630468-119630490 GGCTGGGCCGCCTGGGCAGCAGG + Intronic
1090094544 11:123730119-123730141 GGCTGGTCAGCTAGGGAAGCAGG - Intronic
1090207089 11:124891398-124891420 GGCTGGAGAGCTGGGCCAGCTGG + Exonic
1090259984 11:125312552-125312574 GGCAGGAGGGCCGGGGCAGCGGG + Intronic
1091321451 11:134655260-134655282 GGCTGGAGTGCCTGGGGGGCTGG + Intergenic
1091404717 12:202048-202070 GGCAGGGCAGCCAGGTGAGCAGG - Intronic
1091852654 12:3712807-3712829 GGCTGGACAGCAGGGAAATCAGG + Intronic
1092195840 12:6549266-6549288 ATCTGGAAAGCCGGGGGAGAAGG + Intronic
1092255709 12:6925921-6925943 GGCTGGCAAGCCGGAAGAGCTGG - Intronic
1092721017 12:11440565-11440587 GGAGGGACAGCAGGGGGAGCAGG + Intronic
1096260123 12:50085266-50085288 GGCCGGCCGGCCGGGGGAACAGG + Exonic
1096683552 12:53272896-53272918 GGTTGGGGAGCGGGGGGAGCGGG + Intronic
1096695336 12:53345049-53345071 GGCCGGGCAGCGGGGGGCGCTGG - Intronic
1098410711 12:70180474-70180496 AGCTGGAAAGCCAGGGAAGCTGG - Intergenic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1102471789 12:113163499-113163521 GGCAGGACAGCTGGGTGAGGAGG + Intronic
1102491437 12:113291726-113291748 GGCTGAAGAGCAGGGGCAGCTGG - Intronic
1102520100 12:113472507-113472529 GGGTGGGGAGGCGGGGGAGCAGG + Intergenic
1103953688 12:124565539-124565561 GGGTGGACAGTGGGGGGATCTGG - Intronic
1104954572 12:132457915-132457937 GGGTGGACAGGCAGGTGAGCGGG + Intergenic
1104954619 12:132458051-132458073 GGGTGGACGGGCGGGTGAGCGGG + Intergenic
1104977253 12:132557741-132557763 GGCTGGGGAGTTGGGGGAGCAGG - Intronic
1105218306 13:18303352-18303374 GGCTGGAGAGCCTGAGGAGTGGG - Intergenic
1105753571 13:23444373-23444395 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1106227661 13:27797122-27797144 GGCGGGAGAGGAGGGGGAGCTGG - Intergenic
1108360999 13:49667904-49667926 GGCAGGGCAGCCAGGGGAGGAGG + Intronic
1111265564 13:85807853-85807875 GGCTGCACAGCCGGGTGCGGTGG + Intergenic
1113784834 13:112996982-112997004 GGCCGGGCAGCTGTGGGAGCTGG + Intronic
1114224232 14:20723547-20723569 GGCTGCGCTGCCGGGGCAGCCGG + Intergenic
1118181127 14:63494520-63494542 GGCTGTACAGCCGGGCGCGGTGG - Intronic
1118184520 14:63524723-63524745 GGCTGGCCAGGCCGGGGAGCTGG - Intronic
1118866861 14:69711171-69711193 TGTTGGACAGCTGGAGGAGCTGG + Exonic
1120174146 14:81275758-81275780 CCCTGGACTGCCTGGGGAGCTGG + Intronic
1121012404 14:90528211-90528233 GGCTGGACAGAAGGAGGAGCTGG - Exonic
1121248567 14:92482842-92482864 GGCTGGTGAGTGGGGGGAGCAGG + Exonic
1122120418 14:99550373-99550395 AGCTGGACAGACAGGGAAGCGGG + Intronic
1122425174 14:101601605-101601627 GCCTGGACAGCCTGGCGAGGGGG - Intergenic
1122692350 14:103537392-103537414 TGCAGGACAGCAGGGTGAGCGGG - Intergenic
1122968584 14:105143342-105143364 GGCTGGGCGGCTGGGGCAGCAGG + Intronic
1123699555 15:22904132-22904154 TGCTGGACAGCAGGGGTAGGTGG - Intronic
1123706636 15:22955521-22955543 GGCTGGGGAGGCAGGGGAGCAGG + Intronic
1125506292 15:40269698-40269720 GGCTGGGGAGTCTGGGGAGCTGG - Intronic
1126467316 15:48972915-48972937 TGCTGAGCAGCGGGGGGAGCTGG + Intergenic
1126691964 15:51294702-51294724 GGCTGGCCAGACGGGGCGGCTGG - Intronic
1127868181 15:63048490-63048512 GCCAGGACAGCCGCGGCAGCCGG + Intronic
1128135401 15:65259511-65259533 GGCTGGAAAACCAGGAGAGCTGG + Exonic
1129331620 15:74830751-74830773 GGCTGGACACGCAAGGGAGCTGG - Exonic
1130604806 15:85306557-85306579 GCCTGCACAGCCGGGGCACCCGG - Intergenic
1131676748 15:94677748-94677770 AGCTGGACAGCTGGAGGAGATGG + Intergenic
1132145343 15:99426014-99426036 GTCTGTACAGCCGGGGGTCCTGG + Intergenic
1132426709 15:101724177-101724199 GGCTGCACAGGCGGTGGCGCAGG + Exonic
1132521435 16:391738-391760 GGTGGGACAGCGGGGGGATCAGG - Intergenic
1132585359 16:703813-703835 AGCTGGACACCCTGGGGAGTGGG + Intronic
1132666114 16:1082073-1082095 GGCTGGACAAGGTGGGGAGCAGG - Intergenic
1132939722 16:2500719-2500741 GGCAGGACAGCTGGGACAGCAGG + Intronic
1133002436 16:2858105-2858127 GGCTGGTGGGGCGGGGGAGCAGG + Exonic
1133018003 16:2953823-2953845 GGCTGGAGGGCCGGTGGAACGGG - Intergenic
1133036055 16:3035086-3035108 GGGAGGACAGCCGGGCGAGGGGG - Intronic
1133325179 16:4937592-4937614 GGCTGAACTGCCGAGGGCGCCGG + Intronic
1134095467 16:11415706-11415728 GACTGGACAGCAGTGGGAGAAGG + Intronic
1134219402 16:12341800-12341822 GGCTGGGAAGCTTGGGGAGCAGG + Intronic
1134241579 16:12510729-12510751 GGCTGGACAGCTGGGGGGTGGGG - Intronic
1134341438 16:13350360-13350382 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1136136341 16:28258949-28258971 GGCTGGACAGACAGGGGGACTGG + Intergenic
1136927616 16:34389038-34389060 AGCTGGAGAGCCGGGGGCGCTGG + Intergenic
1136976958 16:35022768-35022790 AGCTGGAGAGCCGGGGGCGCTGG - Exonic
1137300353 16:47143390-47143412 GCCCGGAGAGCCGGCGGAGCCGG + Intronic
1137463870 16:48690446-48690468 GGCTGGAGACCCAGGGAAGCAGG + Intergenic
1137487331 16:48902617-48902639 AGCTGGAGAGGCGGGGGTGCTGG - Intergenic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1139917774 16:70438887-70438909 GTCTGGGCAGCCGGGGGCCCGGG + Intronic
1139923845 16:70475041-70475063 GGCTGGCCAGCTGGGGGCTCGGG + Intronic
1140874416 16:79137727-79137749 GGCTGGAGAGCAGGAGGAGTGGG - Intronic
1141894985 16:86953643-86953665 AGCTGGGCAGGCGGGGGAGTGGG - Intergenic
1141927656 16:87179619-87179641 GGCTGGAAAGCGGGAGGAGGAGG + Intronic
1143099926 17:4499271-4499293 AGCTGCGCAGCCGGGGGTGCCGG - Exonic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1144833653 17:18145277-18145299 GGCTGGAGGGCCAGGGGTGCAGG + Intronic
1145067417 17:19771184-19771206 AGCTGGAAAGCGGTGGGAGCAGG - Intronic
1145875623 17:28316915-28316937 GGCTGGAGAGGAGGAGGAGCAGG - Intergenic
1146053407 17:29569023-29569045 GGCTGGACCGGCGGAGGAGGCGG + Exonic
1146161932 17:30564786-30564808 GGCTAGAAAGCCTGGGGTGCTGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1146920389 17:36706167-36706189 GTCTGGAAAGCCTGGGGAGGGGG + Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147187769 17:38722034-38722056 GGCCGGGCACCCGGGGCAGCGGG + Exonic
1147653065 17:42072850-42072872 GCCTGGTCAGCCGGGGTAGGCGG - Intergenic
1148166936 17:45490427-45490449 GGCTGGACAGACGGAGGGGACGG + Intronic
1148265905 17:46225468-46225490 GGCGGGACAGAAGGGGGAGAGGG + Intergenic
1148502323 17:48101228-48101250 GGCGGGAGAGCTGGGGGAGGGGG - Intronic
1148618439 17:49016814-49016836 GGGAGGACAGGCGGGGGGGCAGG - Intronic
1148714424 17:49705720-49705742 GGATGGGCAGCAGGGAGAGCTGG + Intronic
1148749340 17:49935594-49935616 AGCTGGACAGCCGGGGGTGGGGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150221244 17:63497024-63497046 GGCTGCCCAGCCTGGGGAGGGGG - Intronic
1150398115 17:64836831-64836853 GGCTGGACAGACGGAGGGGACGG + Intergenic
1150875384 17:68964149-68964171 GGCTGGACAGGAGGGTGAGCTGG + Intergenic
1151537979 17:74749346-74749368 GGCTGGACGGCCGGGGCACCTGG - Intronic
1151680454 17:75620157-75620179 GGCAGGCCAGCAGGGGGAGCAGG + Intergenic
1151683601 17:75634430-75634452 TGCTGCACAGCAGGCGGAGCAGG - Intronic
1151683950 17:75636094-75636116 GGCTGGGCAGCCTGGGCAGCAGG + Intronic
1151822887 17:76506638-76506660 GGCTGGACTGCCAGGGTATCTGG - Intergenic
1152181215 17:78822918-78822940 GGCTGGAGAGCCTGGGGAGAGGG - Intronic
1152199093 17:78934796-78934818 TGCTGGACAGCAGGAAGAGCAGG + Intergenic
1152229299 17:79106541-79106563 GGCAGGAAACCCGGGGGAACAGG + Intronic
1152703279 17:81830075-81830097 GGCTGGACGGCCACGGAAGCAGG - Intronic
1152791708 17:82283634-82283656 GGGTGGACACCCTGGGGAGGAGG - Intergenic
1152853498 17:82650399-82650421 GGCTGTACAGCCGGGGGCGGGGG + Intergenic
1152926684 17:83090605-83090627 GGCTGGGCAGCCATGGCAGCTGG - Intronic
1153979283 18:10295559-10295581 GCCTGCACAGCCTGGGGACCAGG - Intergenic
1157677374 18:49578052-49578074 GGCTGGCCGGGCGGGGGGGCTGG + Intronic
1160300348 18:77672409-77672431 GCCTGGGGAGACGGGGGAGCGGG + Intergenic
1160624367 18:80192814-80192836 GGCTCGCCGGCCGTGGGAGCTGG + Intronic
1160707725 19:537207-537229 GGCTGGGCGGCCGTGGGACCAGG - Intronic
1160918875 19:1510587-1510609 GGCTGGGCCGGCGGGGGAGGAGG + Intronic
1161323030 19:3649995-3650017 CGCTGGCCTGGCGGGGGAGCAGG - Intronic
1161492090 19:4567697-4567719 GGAAGGACAGCCTGGGGATCAGG - Intergenic
1162046693 19:8005203-8005225 GGCTGCACGGCCGGGGGCCCCGG - Intronic
1162540832 19:11294946-11294968 GGCTGGACAGAGAGGGGATCGGG + Intergenic
1163135019 19:15304208-15304230 GGCTGGAGATCCGGGGGACCTGG - Intronic
1163502862 19:17686859-17686881 GGGTGGGCAGGCCGGGGAGCCGG - Intronic
1165443305 19:35843273-35843295 GGCTAGACAGCCAGGCGAGTGGG - Intronic
1166331295 19:42079460-42079482 GGCGGGATCGCCGGGGGCGCAGG + Exonic
1166343706 19:42152685-42152707 GCTTGGACAGCCGGGAGAGGGGG + Intronic
1166366201 19:42279883-42279905 GGCTGCTAAGCTGGGGGAGCTGG - Intronic
1166368962 19:42291085-42291107 AACTGGACAGCAGGGGGCGCAGG - Exonic
1166386867 19:42387307-42387329 GGCTGGGGACCCGCGGGAGCAGG - Intronic
1166750533 19:45162205-45162227 TGCTGGACACTAGGGGGAGCAGG + Intronic
1166759041 19:45213134-45213156 GCCTGGCCAGCCGGGAGAGGGGG + Exonic
925390449 2:3490511-3490533 GTCCGCACAGCCTGGGGAGCGGG + Intergenic
925644853 2:6025466-6025488 GACAGGAAAGCCAGGGGAGCAGG + Intergenic
926421280 2:12702163-12702185 TGCTGGAGAGCCAGGTGAGCTGG - Intergenic
927144014 2:20149151-20149173 GAATGGACAGCCAGGGGAGATGG - Intergenic
927496255 2:23553786-23553808 GGCTGGGCATCCGGGGCAGGGGG - Intronic
929788870 2:45009786-45009808 GACAGGAGAGCGGGGGGAGCGGG + Intergenic
930021067 2:47002587-47002609 AGCAGGACAGCTGGGGGTGCTGG + Intronic
930482386 2:51965404-51965426 GGGTGGACAGCGGAGGGTGCTGG - Intergenic
931728214 2:65130581-65130603 GGAGGGACTGCCGGGGGTGCGGG + Intergenic
932718378 2:74120204-74120226 GGTTGGGCGGGCGGGGGAGCCGG - Intergenic
932853514 2:75210644-75210666 GGCGGGATACCAGGGGGAGCAGG + Intergenic
933426918 2:82125705-82125727 AGCTGGAGAGCCAGGGGAGTTGG + Intergenic
934295992 2:91743280-91743302 GGCTGGAGAGCCTGAGGAGCAGG + Intergenic
935758225 2:106294922-106294944 GGCTGGGCAGGTGGGGGAGTGGG - Intergenic
936862388 2:117033000-117033022 GGCTGGAATGGCTGGGGAGCAGG + Intergenic
937293419 2:120795698-120795720 GGCTGGACACCTGGAGGAGTGGG - Intronic
937868357 2:126770549-126770571 GGTTGGAGAGCTGGGAGAGCAGG + Intergenic
937957574 2:127430231-127430253 AGCTGGAGAGCCCGGGAAGCCGG - Intergenic
938034743 2:128027218-128027240 GGCTGGACAGCAGCGGGCCCCGG - Exonic
938577550 2:132618873-132618895 GGGTGGACAGCCCTGGGACCAGG + Intronic
946310668 2:218880924-218880946 GACTGGAGAGCCAGGGGCGCCGG - Exonic
946372550 2:219289808-219289830 GGCTGAGAAGCAGGGGGAGCCGG + Exonic
946374891 2:219302139-219302161 GGCTGCACAGCTGGGGAAGCAGG + Exonic
947669300 2:231926338-231926360 GGCTGGGCTGCAGGGCGAGCAGG + Exonic
948835525 2:240624342-240624364 GGAGGGACAGCCGGGGAAGCAGG + Intronic
948877530 2:240837599-240837621 GGCTGGAGAGCAGGAGGAGAGGG + Intergenic
949012197 2:241687091-241687113 GGCTGGACGGCCGGAGACGCGGG + Intergenic
1168971955 20:1937371-1937393 GGCTCCGCAGCCTGGGGAGCAGG - Exonic
1169266574 20:4170811-4170833 CTCTGGACAGCTGGGGGAGGCGG + Intronic
1169767225 20:9160081-9160103 GCCAGGACAGCAGGGTGAGCTGG + Intronic
1170571411 20:17634873-17634895 AGCTGGACAGGGAGGGGAGCTGG - Intronic
1170621337 20:17998958-17998980 GGCTGGAAAACCAGGGAAGCTGG + Intronic
1171365104 20:24617881-24617903 GGGTTGAGAGCCCGGGGAGCGGG + Intronic
1171430290 20:25079031-25079053 GTCTGGACAGCAGAGGAAGCAGG - Intronic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1173868965 20:46330140-46330162 GGTTGGGCTGCCAGGGGAGCTGG + Intergenic
1174759044 20:53188265-53188287 GGCTGTAGAGCTGGGGGAACAGG - Intronic
1175390596 20:58624926-58624948 GGCTGGAGAGCAGGGGGAGGCGG + Intergenic
1175487007 20:59353857-59353879 AGCTTGACAGCCTGGGGAACAGG + Intergenic
1175774558 20:61644826-61644848 GGCTGGACAGGCCGGGGAGGAGG - Intronic
1176301287 21:5100237-5100259 GGCTGGACACGCAGGGGGGCTGG - Intergenic
1176301326 21:5100344-5100366 GGCTGGACACGCGGGGGGGCCGG - Intergenic
1178580266 21:33832144-33832166 GGCAGGAGAGCAGGGGGTGCTGG - Intronic
1178919948 21:36732237-36732259 GGCTGGACAGCAGGAGGATGAGG - Intronic
1179000412 21:37452474-37452496 GTCTGCACAGGCTGGGGAGCAGG - Intronic
1179154589 21:38838886-38838908 GGCTGAGCAACCGGGAGAGCAGG - Intergenic
1179855705 21:44161555-44161577 GGCTGGACACGCGGGGGGGCCGG + Intergenic
1179855743 21:44161662-44161684 GGCTGGACACGCAGGGGGGCTGG + Intergenic
1180105872 21:45617691-45617713 GGCTGAGCAGCAGAGGGAGCTGG - Intergenic
1180174383 21:46080647-46080669 GGCTGGGCTGCAGTGGGAGCTGG - Intergenic
1181032190 22:20153992-20154014 GGCAGGACAGCAGTGGGAGCTGG - Intergenic
1181033745 22:20160229-20160251 AGCTGGAGGGCCGGAGGAGCTGG - Intergenic
1181079053 22:20401657-20401679 GGCTGGGCAGCCGGGGGTGTGGG + Intronic
1181366427 22:22380528-22380550 GGCTGGACACCAGGGGACGCTGG + Intergenic
1181511268 22:23389739-23389761 GGCAGGACAGCAGCGGGAGCTGG + Intergenic
1181618530 22:24071659-24071681 GGCTGGAAAGCGGCTGGAGCGGG - Intronic
1181768848 22:25111501-25111523 GGCTGCTCAGCCAGGGGACCCGG + Intronic
1181934495 22:26429221-26429243 CGCTGGGCCGCCGGGGGAGGGGG - Intergenic
1182296118 22:29311900-29311922 GGCTGGAGACCCGGGAAAGCCGG - Intronic
1182496034 22:30708173-30708195 GGCTGAACAGCCAGGCGAGGTGG - Intronic
1183173459 22:36204824-36204846 GGCTGGACTGCAGGAGGTGCTGG - Exonic
1183187066 22:36298242-36298264 GAGTGGACAGCTGGGGGAACAGG - Intronic
1183585955 22:38753052-38753074 GGCTGGACCACCGGGCGTGCAGG - Intronic
1183976200 22:41513808-41513830 GGCTGGACAGATGGGGGTGAGGG - Intronic
1184092941 22:42301869-42301891 GGCTGGACGGCCACGGGGGCTGG + Intronic
1184170640 22:42757568-42757590 GACTGGACAGGCGGGACAGCAGG - Intergenic
1184409296 22:44317378-44317400 GGCTGGACAGCGAGGGAAACAGG + Intergenic
1184486573 22:44783438-44783460 GGCTGCAGAGAAGGGGGAGCAGG - Intronic
1184550718 22:45202962-45202984 GGCTGCACAGCTGGGGGCGGGGG - Intronic
1185171746 22:49298360-49298382 AGCTGGAGACCCGGGAGAGCTGG + Intergenic
1185238611 22:49728746-49728768 AGCTGGACACCCGAGAGAGCCGG + Intergenic
1185238616 22:49728763-49728785 AGCCGGACACCCGGGAGAGCCGG + Intergenic
1185238622 22:49728780-49728802 AGCCGGACACCCGGGAGAGCCGG + Intergenic
1185238628 22:49728797-49728819 AGCCGGACACCCGGGAGAGCCGG + Intergenic
950084605 3:10248589-10248611 GGCGGGACAGCTGCGGCAGCCGG + Exonic
950634999 3:14308190-14308212 GGCTCACCAGCCGGGGGAGGAGG - Intergenic
950660113 3:14461923-14461945 GGCTGAGCAGCAGGGGGAGCCGG - Intronic
950796019 3:15511366-15511388 GGCTGGACAGGCTTAGGAGCCGG - Intronic
951611389 3:24495323-24495345 GGCTGGGCAGCCCGGGGCGGTGG - Intergenic
951962775 3:28348371-28348393 GCCTGGACAGCTGGGGGTGAGGG + Intronic
952548649 3:34450481-34450503 GGATGGAGAGCCTGGGGAGTAGG - Intergenic
953793897 3:45968215-45968237 GGCTAGCCAGCCTGGGAAGCTGG + Exonic
954078748 3:48200150-48200172 AGCTGGCCAGCCTGGGGACCTGG - Intergenic
954228500 3:49198933-49198955 GGCAGGACAGGCGGAGCAGCTGG - Exonic
954433058 3:50481492-50481514 GGGTGGGCAGCAGGGGAAGCAGG + Intronic
956068834 3:65426040-65426062 GACTGGACAGCAGAGGGAGAAGG + Intronic
956390802 3:68770951-68770973 GGCTGGACATCAAGAGGAGCAGG + Intronic
958425458 3:93973889-93973911 GGCGGAACAGCCGGGGGCGGAGG + Exonic
961466679 3:127085937-127085959 GGCTGGAGAGACGGGGCTGCTGG + Intergenic
965818322 3:172659543-172659565 GGCTGCACAGCTAGGGGACCGGG - Intronic
967316189 3:188154031-188154053 GGCTGCACGGCCCGGGGCGCGGG + Intronic
967828486 3:193898025-193898047 GGCTGGAGAGCCGGGAAGGCGGG + Intergenic
967955800 3:194876583-194876605 GGCTGGCCAGCAGGGGCAGGAGG - Intergenic
968503307 4:961013-961035 GGCTGGAGAGCCAGGGGAGGTGG - Intronic
969072569 4:4551352-4551374 GGCTGGAGAGGCTGGGGTGCAGG - Intergenic
969413121 4:7042668-7042690 GCCTGGAGAGCCGGGGAGGCCGG - Exonic
970204866 4:13645599-13645621 GGCTGGACAGCGGTGGGTGAGGG + Intergenic
970463666 4:16301930-16301952 GGCTGGACATCCAGGGTAGAAGG - Intergenic
971371399 4:26022210-26022232 CCCTGGACAGCCGGGTAAGCAGG + Intergenic
971874515 4:32289554-32289576 AGCTGGAAAACCGGGGAAGCTGG + Intergenic
972589395 4:40470211-40470233 GGCTGGGGGGCGGGGGGAGCTGG - Intronic
974800552 4:66812147-66812169 AGCTGGAGAACCAGGGGAGCTGG + Intergenic
978845842 4:113271800-113271822 TGCTGGACAGACTGGAGAGCAGG + Intronic
979489028 4:121303331-121303353 GGCTGGAGAGCCATGGAAGCTGG - Intergenic
981037352 4:140186432-140186454 GGCAGGACAACAGGGAGAGCAGG + Intergenic
982274226 4:153622994-153623016 GCCGGGGCAGCTGGGGGAGCTGG + Exonic
983940250 4:173529457-173529479 GGCTGGCCAGGCGGGGGGACGGG - Exonic
984972932 4:185206819-185206841 GGCTGGAGAGCCTGGAAAGCTGG + Intronic
986383349 5:7208158-7208180 GTCTGGACAGAGGGGTGAGCTGG - Intergenic
986449312 5:7850294-7850316 GGCTGGACAGCCTGTGGAGGGGG - Intronic
987499312 5:18686770-18686792 GGCTGAGCAGCTGGGGGAGGAGG - Intergenic
990524919 5:56615776-56615798 GGAAGGGCAGCCGTGGGAGCAGG + Intergenic
994631709 5:102295832-102295854 GGCGAGCCAGCCGGGGGAGAGGG - Intronic
998431752 5:142075543-142075565 GGCTGGCCGGGCGGGGGGGCTGG + Intergenic
999666224 5:153916521-153916543 GGATGGAGTGCCAGGGGAGCGGG - Intergenic
1001566188 5:172700882-172700904 GCCTGGGCTGCCAGGGGAGCAGG + Intergenic
1001940810 5:175738273-175738295 GGTTGGAGAGCCCAGGGAGCTGG + Intergenic
1002076678 5:176712613-176712635 GGCAGCACAGCCGATGGAGCAGG + Intergenic
1002168649 5:177363085-177363107 GGCGGTGCAGCCGGGGGAGGAGG + Intronic
1002792646 6:447229-447251 TGCTGGAGAGCCGGGTGAGGTGG - Intergenic
1003527949 6:6913598-6913620 GGCTGGGCACCCCAGGGAGCTGG - Intergenic
1005385165 6:25278989-25279011 GGGAGGAGAGCCGGGTGAGCCGG - Intergenic
1005463128 6:26087724-26087746 GCCGGGACAGCCGGGGGAGGGGG - Intronic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1006255462 6:32829179-32829201 GGCAGTACAGCCGGGAGAGAAGG - Intronic
1006368923 6:33632691-33632713 GTCTGAACAGCAGAGGGAGCAGG - Intronic
1006373729 6:33660246-33660268 GGCTGTCCAGCTAGGGGAGCAGG + Intronic
1006425255 6:33959444-33959466 GCCTGCACAGCCTGGGGAGTGGG - Intergenic
1006458412 6:34144696-34144718 GGCGGGACAGGCGGGGGCGCGGG - Intronic
1006739408 6:36296705-36296727 GGCTGGACGGACAGGAGAGCAGG + Intronic
1007322338 6:41036840-41036862 GGCTGGGTAGCCAGGTGAGCAGG - Intronic
1007936940 6:45740885-45740907 GGCTGGGCAGAAAGGGGAGCAGG + Intergenic
1008537558 6:52518316-52518338 GGCTGGACTGCTGGGGGCGGAGG + Intronic
1011350344 6:86416147-86416169 GGCAGCAGAGCTGGGGGAGCTGG + Intergenic
1013265565 6:108494169-108494191 GGCAGGGGAGCAGGGGGAGCGGG - Intronic
1013273194 6:108560836-108560858 GGCTGGGCGGCGGGGGGAGGGGG + Intronic
1018611254 6:165649638-165649660 GACTGGACAGCAGGGGCAGTGGG - Intronic
1018778999 6:167045356-167045378 GGCTGGGCCGCGGGGGGGGCGGG - Exonic
1018862315 6:167720104-167720126 GGCTGGAGAGCAGGGACAGCGGG - Intergenic
1019574283 7:1728837-1728859 CGCTGGACACACGGAGGAGCTGG - Intronic
1019711556 7:2520308-2520330 GCCTGGACTGGCGGGCGAGCGGG + Intronic
1019866135 7:3712128-3712150 GGCTGCACAGCAGGAGGCGCAGG + Intronic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1021263908 7:18495549-18495571 GGCTGGACAGCTGGGTTTGCTGG + Intronic
1026889606 7:73974254-73974276 TGCTGGACTGCTGGGGGAACAGG + Intergenic
1028415813 7:90579583-90579605 GCCTGGACAGCAGAGGGAGACGG - Intronic
1029287432 7:99475505-99475527 GGCTTGTCAGCAGGTGGAGCTGG + Intronic
1029401879 7:100352084-100352106 CCCTGGACAGCAGGGGGTGCCGG - Intronic
1029570076 7:101363282-101363304 GGCTGGAGAGCGGGGCGATCCGG + Intronic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1031927452 7:127651964-127651986 GGCGGGACTTCCGGGGCAGCCGG - Intergenic
1032345944 7:131116862-131116884 GGCTGGCCAGGCTGGGAAGCAGG + Intronic
1034439181 7:151077822-151077844 GGCTGGAGAGGCAGGGGAGCAGG - Intronic
1034545092 7:151784306-151784328 TGCTGGGGAGCCGGGGGAGAGGG + Intronic
1034618097 7:152436081-152436103 GGCGGGGCAGCCGGGCGGGCGGG + Intergenic
1036675128 8:10825203-10825225 GCCTGGATAGCAGTGGGAGCTGG - Intronic
1036699377 8:11001889-11001911 GGCTGAACAGCAGAGGGACCAGG - Intronic
1037804259 8:22050408-22050430 GGCCGGAGAGCCGGGCTAGCGGG - Intronic
1037900900 8:22688834-22688856 GGCAGGACAGCTGGGGAAGAGGG + Exonic
1039395963 8:37225368-37225390 GGATGGACAGGCAGGGGAGAAGG - Intergenic
1040409706 8:47141846-47141868 GGCTGGAAAGCTGGGGGTGTGGG - Intergenic
1040863225 8:52022535-52022557 AGCAGGCCAGCCCGGGGAGCTGG - Intergenic
1045516424 8:102864228-102864250 GGCCGGGCAGCCGCGCGAGCGGG + Exonic
1045911274 8:107413321-107413343 GGCTGGGGAGCAGAGGGAGCAGG - Intronic
1047436990 8:124843038-124843060 GGGTGGACTGCCAGGGGAGATGG - Intergenic
1047537963 8:125736679-125736701 GGCTGGAGACCCAGGAGAGCTGG - Intergenic
1048456158 8:134580053-134580075 GGCAGGGCAGCCAGGAGAGCAGG + Intronic
1049109931 8:140636000-140636022 GGCGGCACAGCCGGGGGGCCCGG - Intergenic
1049156875 8:141072771-141072793 GCCTGGACTGCAGGGGGAGGGGG - Intergenic
1049186891 8:141259975-141259997 GGCTGGTCACCCGGGGCACCTGG - Intronic
1049206507 8:141366155-141366177 GGCTGGAGAGCCGGGCGTGGGGG - Intronic
1049685516 8:143937772-143937794 GGCCGGGCAGCCGAGGGAGCGGG - Intronic
1049733838 8:144192827-144192849 GGCTGAGCAGCTGGGGCAGCTGG + Intronic
1049762129 8:144336488-144336510 CCCTGGACAGGCGGGGGAGGAGG + Intergenic
1049790109 8:144468526-144468548 GGCGGGGCAGCTGGGGGTGCAGG + Exonic
1051810936 9:21048929-21048951 GGCTGGAGAACCAGGGAAGCCGG + Intergenic
1052682067 9:31706234-31706256 GGCTGGAAACCCAGGGAAGCTGG - Intergenic
1057439561 9:95073135-95073157 AGCAGGACAGCAGAGGGAGCAGG - Intronic
1057673823 9:97121271-97121293 GGCTAGACTGGCGGGCGAGCGGG - Intergenic
1059119762 9:111631432-111631454 GGCTGGGGAGCCGGGGCTGCCGG + Exonic
1060152602 9:121298486-121298508 GGCTGGACTTCCGGAAGAGCTGG + Intronic
1061489782 9:130938613-130938635 GGCAGGACTGGCGGGGGCGCCGG + Exonic
1061875101 9:133539662-133539684 GCCGGGACAGCCGGGACAGCCGG - Intronic
1062212189 9:135371160-135371182 GCCTGGGCAGCAGGGGGAGCTGG - Intergenic
1062212806 9:135373701-135373723 AGAAGGACAGCCTGGGGAGCGGG - Intergenic
1062255907 9:135620310-135620332 GACTGGGCAGACGGGGGAGACGG - Intergenic
1062291578 9:135797645-135797667 GGATGGACTTCTGGGGGAGCTGG - Intergenic
1062481359 9:136754010-136754032 GGCTGGGCAGCTGGGGGTCCAGG + Intergenic
1062528053 9:136986126-136986148 GGCTGGGGAGCTGGGGGACCCGG - Intronic
1062615670 9:137394689-137394711 GGCAGGGCAGCCGAGCGAGCGGG + Intronic
1186750604 X:12618267-12618289 GGCTGGCTAGCCGTGGGAGTGGG - Intronic
1191220789 X:57985862-57985884 TGCTGGAGAGCGAGGGGAGCTGG + Intergenic
1192248742 X:69393607-69393629 TGCTGCACTGCTGGGGGAGCAGG + Intergenic
1198015361 X:132604907-132604929 GTCTGGACAGCAGGGGGACATGG - Intergenic
1200124019 X:153804817-153804839 AGCTGGACAGCGGGGTGGGCCGG - Exonic