ID: 1089479550

View in Genome Browser
Species Human (GRCh38)
Location 11:118792979-118793001
Sequence GATTGGAGGATGTTGGCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 13, 3: 69, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089479550 Original CRISPR GATTGGAGGATGTTGGCATC GGG (reversed) Intergenic
901617076 1:10549716-10549738 CATTGGAGGATTTTGGAATAGGG - Intronic
902368091 1:15990336-15990358 GATGGGGAGATGTTGCCATCAGG - Intergenic
902536346 1:17121112-17121134 GATTGGAGGATGTGCTCAGCCGG - Intergenic
905357216 1:37393137-37393159 GGTTGGTAGGTGTTGGCATCAGG - Intergenic
906593466 1:47050272-47050294 GATTGGAGGTTGGTGGGATAGGG + Exonic
906606875 1:47179042-47179064 AATTGGAAGACGATGGCATCAGG - Intergenic
907757211 1:57322428-57322450 GAATGGAGTGTGTTGGCATGGGG - Intronic
908100550 1:60786581-60786603 GATAGGAGGTTGTTGGGATTGGG + Intergenic
908256726 1:62309174-62309196 GCTTGCAGACTGTTGGCATCTGG + Intronic
910078407 1:83308542-83308564 TATTGGAAGATGATGCCATCTGG - Intergenic
910347347 1:86255210-86255232 GAATGGAGGATGTGGGCTCCAGG + Intergenic
912657066 1:111496343-111496365 GATTGGAGGCTGTTGGCTTGGGG - Intronic
913496552 1:119433181-119433203 GATAGGAGGGTGGTGGAATCTGG + Intergenic
913509285 1:119547654-119547676 GATAGGAGGGTGGTGGAATCTGG + Intergenic
914710364 1:150207743-150207765 GATTGGAAGCTGTTGGCATGAGG - Intergenic
914750486 1:150531808-150531830 GATTGGAGGCTGTTGGTGTGGGG - Intergenic
914952035 1:152124653-152124675 GCTGGGAGGATGTTGGGGTCTGG + Intergenic
918267733 1:182861385-182861407 TATTGGAGTATGATGACATCTGG - Intronic
920424052 1:205859280-205859302 TAATGGAGGATGTTGCCATCGGG + Intergenic
921245914 1:213240190-213240212 GATTGGAGGAATTTGGCATGTGG - Intronic
922332829 1:224592733-224592755 GTTGGGAGGATGTGGGCATTTGG + Intronic
922341681 1:224661907-224661929 GGTCGGAGGATGTGGGCAGCTGG + Intronic
922368116 1:224885031-224885053 GATTGGAGGCTGTTGGCAATGGG + Intergenic
922369803 1:224897917-224897939 GATTGGAAGCTGTTGGCATGGGG + Intronic
922992574 1:229927334-229927356 GATTTGGGGATCTTGGCATAAGG - Intergenic
923365383 1:233255333-233255355 GATTGGAGGTTATGGGCATTAGG - Intronic
923905150 1:238376283-238376305 GATCGGAGGCTGTTGGCCTGAGG + Intergenic
924325049 1:242887407-242887429 GATTGGAGGCTCTTGACATGGGG - Intergenic
924642717 1:245849338-245849360 AAATGGAGGAATTTGGCATCGGG + Intronic
1063882188 10:10542568-10542590 GATTGGAGGCTGTTGGAATAGGG + Intergenic
1069144764 10:64876895-64876917 GATTGGAGGTTATTGGCATAAGG - Intergenic
1070587544 10:77777962-77777984 GATCAAAGGCTGTTGGCATCTGG - Intergenic
1070612065 10:77940207-77940229 GATTGGAGGCTGTTGACATCAGG - Intergenic
1070986837 10:80696606-80696628 GATTTGAGGCTGTTGGCTGCAGG + Intergenic
1071049423 10:81428463-81428485 GATTGGGGGATGTAGTCATCAGG + Intergenic
1071227198 10:83544284-83544306 GATTGGAAGTTGTTGGCGTGGGG + Intergenic
1073522519 10:104146928-104146950 CATTGGAAGTTGTTGGCATGAGG - Intronic
1075000408 10:118792794-118792816 GATTGGAGGTTGTTGGCCTAGGG - Intergenic
1075053771 10:119203081-119203103 GTATGGAGGTTGTTTGCATCCGG + Intergenic
1075085584 10:119412403-119412425 GGCTGCTGGATGTTGGCATCAGG + Intronic
1075575432 10:123573987-123574009 CATTGGAGGTTCTGGGCATCTGG + Intergenic
1077042714 11:531637-531659 GAGTGGACGAGGTTGGCAGCTGG - Intergenic
1078679283 11:13460695-13460717 GATTGGAGGGGTTTGGCAACAGG - Intronic
1079341739 11:19617303-19617325 CTTAGGAGGATGTTGGCAGCTGG + Intronic
1081319511 11:41674130-41674152 GATTGGTGGCTGCTGGCATGGGG - Intergenic
1083010062 11:59388518-59388540 GATTGTAGGATCTAGGCTTCTGG - Intergenic
1085247004 11:75109910-75109932 GATTGGAGGATGTTGCTAAAAGG - Intronic
1088409718 11:109520747-109520769 GATTGGAGGTTGTTAGCAGAGGG + Intergenic
1088690070 11:112318747-112318769 GACTGGAGGCTGTTGGCATGGGG - Intergenic
1089479550 11:118792979-118793001 GATTGGAGGATGTTGGCATCGGG - Intergenic
1090037675 11:123263022-123263044 GATTGGAGGCTGTTGGCATTTGG + Intergenic
1090168471 11:124577070-124577092 AATTGGAGGTTGTTGGCACTGGG + Intergenic
1093512865 12:19949535-19949557 GTTTAGAGGCTGTTGGCATGGGG - Intergenic
1095379278 12:41570023-41570045 GATAGGAGGATGTTGGAATAAGG + Intronic
1095724436 12:45436236-45436258 GATTGGTGGCTGCTGGCATGGGG - Intronic
1096260695 12:50088670-50088692 GATTGGAGGATGATGGACTTGGG + Intronic
1096449800 12:51728905-51728927 GAATGGAGGCTGTTGGCATGGGG - Intronic
1098024914 12:66191143-66191165 GATTGGAGGCTGTTGATATGGGG + Intronic
1099630474 12:85136368-85136390 TATTGGAGGTTGTTGGCATGGGG + Intronic
1099664219 12:85606702-85606724 GATTGGAGGCTCTTGGAATGGGG + Intergenic
1100787851 12:98097526-98097548 GATGTGAGGATTTTGGTATCAGG + Intergenic
1101803358 12:108042142-108042164 GATTGGAGGCTGTTGGCATGGGG - Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1104724425 12:131067050-131067072 GAGTGGAGGATGTTAGCTTCAGG + Intronic
1105766906 13:23568786-23568808 GAGTGCAGGCTGTTGGCATATGG + Intergenic
1106105935 13:26733615-26733637 GATTGGAGGCTGTTGGCGTGAGG - Intergenic
1106871758 13:34029453-34029475 GATTGGAGGCTGTTGGTGTGGGG - Intergenic
1107284988 13:38780845-38780867 CATTGGAGGCTGTTGGCATGGGG - Intronic
1109408182 13:61927937-61927959 GATTGGAGGCCATTGGCATGCGG + Intergenic
1109438276 13:62335067-62335089 GACTGGAGGCTGTTGGCATGGGG - Intergenic
1110725241 13:78815409-78815431 GCATGGAGGATGGTGACATCAGG + Intergenic
1111079815 13:83289319-83289341 AGTTGGAGGCTGTTGGCATAGGG - Intergenic
1111809097 13:93075832-93075854 GATTGTCAGATGCTGGCATCTGG + Intergenic
1112586140 13:100720643-100720665 GATTGGAGGCTGTTGGCCTGGGG - Intergenic
1112604270 13:100888747-100888769 GATTGAAGGCTGTTGACATAGGG + Intergenic
1113537707 13:111081523-111081545 CATTGGAGGATGCTGGCCCCTGG - Intergenic
1114426962 14:22631833-22631855 GACTGGAGGATTTTGGCATGGGG - Intergenic
1115786887 14:36836652-36836674 GAATGGTGGAGGTAGGCATCAGG + Intronic
1116110708 14:40576962-40576984 GGTTGGAGGCTATTGGCATGAGG - Intergenic
1120159106 14:81127056-81127078 AATTGGAGGATGCTGGCAACAGG + Intronic
1121240141 14:92423777-92423799 GGGTGGAGGCTGTTGGCATGAGG + Intronic
1124162853 15:27289677-27289699 GAATGGAAGATGGTGGGATCTGG + Intronic
1125006809 15:34825717-34825739 GCTTGGAGGTTGTTGGCATGAGG - Intergenic
1130814609 15:87418113-87418135 GATTGGAGGCTGTTGGCACAGGG + Intergenic
1131548773 15:93338542-93338564 GATTGGGGGCTGTTGGCCTGAGG + Intergenic
1132015020 15:98307810-98307832 CATTGGAGGCTGTTGGTGTCAGG + Intergenic
1132220861 15:100104051-100104073 AATTGGAGAATGTTGGCTACAGG + Intronic
1134334500 16:13285353-13285375 AATTGAACGATGTTGGCAGCTGG + Intergenic
1135728555 16:24875854-24875876 GATTAGAGGAAGATGGCATGGGG + Intronic
1136156705 16:28387915-28387937 GACTGCAGGATGCTGGCAACTGG + Intronic
1136206381 16:28727366-28727388 GACTGCAGGATGCTGGCAACTGG - Intronic
1140819364 16:78648687-78648709 GATTGGAGGCTGTGGACATGGGG - Intronic
1141375479 16:83526380-83526402 GATTGGAGGAGGATGGTTTCCGG + Intronic
1144220129 17:13092303-13092325 GATTGGAGGCAGTTGGCGTAAGG - Intergenic
1144486342 17:15668128-15668150 GAGTGGAGGATGTGGAAATCAGG - Intronic
1144914681 17:18714163-18714185 GAGTGGAGGATGTGGAAATCAGG + Intronic
1145285590 17:21503857-21503879 GAGTGGAGGCTGTTGGCTTGGGG + Intergenic
1145391937 17:22461880-22461902 GAGTGGAGGCTGTTGGCTTGGGG - Intergenic
1152151539 17:78604300-78604322 GATTGGAGGCTGTTGGCACAGGG - Intergenic
1152588781 17:81200891-81200913 GACTGGTGGCTGCTGGCATCTGG + Intronic
1152722901 17:81931577-81931599 TATGGGTGGATGTGGGCATCAGG - Intergenic
1154128240 18:11713316-11713338 GATTGGAGGCTGTTGGCGTGGGG + Intronic
1154223521 18:12478817-12478839 TATAGGTGGATGTTGACATCAGG + Intronic
1154427339 18:14282031-14282053 GTCTGGAGGATGGTGGCATGGGG + Intergenic
1154430065 18:14301567-14301589 GTCTGGAGGATGGTGGCATGGGG + Intergenic
1154506971 18:15050929-15050951 GTTTGGAGGGTGTGGCCATCAGG + Intergenic
1155615254 18:27714703-27714725 GACTGGAGGCTATTGGCATGGGG - Intergenic
1156088494 18:33438284-33438306 GACTGGAGGTTGTTGACATGGGG - Intronic
1156991478 18:43413970-43413992 GATGGGAGGAAGCAGGCATCAGG - Intergenic
1157016021 18:43714513-43714535 CATTGTAGGCTGTTGGCATGGGG + Intergenic
1158118158 18:54019570-54019592 GATTGGAGGCTGTTGGCATGGGG + Intergenic
1158499560 18:57987989-57988011 GATTGAAGGCTGCTGGCATGCGG + Intergenic
1158999081 18:62954582-62954604 AATTACAGGATGTTGGTATCTGG - Intronic
1159017411 18:63112572-63112594 GATGGGAGGTTGTTGGCATAGGG - Intergenic
1159305998 18:66643000-66643022 GATTGGAGTATCTTGGAATATGG + Intergenic
1159611162 18:70527185-70527207 GATTGGAGGCTGTTGGCACCAGG + Intergenic
1159862102 18:73661379-73661401 GATTGGAGGCTGTTGGCCTGGGG - Intergenic
1164434945 19:28221011-28221033 GATTGAAGGCTGTTGGCACAGGG + Intergenic
1165337892 19:35185529-35185551 GATAGGAAGATGTTGGCAAATGG + Intergenic
1165491842 19:36128069-36128091 GATTGTGGGATGTAGGCATTTGG + Intergenic
1165714855 19:38037777-38037799 GATTGGAGGCTTTTGGCTCCAGG + Intronic
1166105993 19:40598300-40598322 GAGTGGAGGATGAGGCCATCTGG - Intronic
1166906553 19:46114274-46114296 GATTGGAGGCTGTTGGCATGGGG - Intergenic
1167788312 19:51654254-51654276 GATTGGAGGCTATTGGCCTGGGG + Intergenic
1168412868 19:56150753-56150775 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412881 19:56150831-56150853 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412895 19:56150909-56150931 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412909 19:56150987-56151009 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412923 19:56151065-56151087 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412937 19:56151143-56151165 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412950 19:56151221-56151243 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412962 19:56151299-56151321 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412976 19:56151377-56151399 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168412990 19:56151455-56151477 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168413004 19:56151533-56151555 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168413018 19:56151611-56151633 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168413053 19:56151815-56151837 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168413066 19:56151893-56151915 GATTGGGGTTTCTTGGCATCTGG + Intronic
1168430008 19:56271221-56271243 GGTTGGAGGCCGTTGGCATAAGG - Intronic
925314400 2:2909958-2909980 GCTTGGAGGAGGCTGCCATCAGG + Intergenic
925490532 2:4387605-4387627 GATTGTTGGCTGTTGGCATATGG + Intergenic
927209802 2:20632126-20632148 GATTGGAGGTTATTGGCATGGGG - Intronic
927283381 2:21331344-21331366 TATTGGAGGTTTTTGGCATAAGG - Intergenic
928109808 2:28497451-28497473 GGTTGGAGGTTGTTGGTATCAGG + Intronic
928179469 2:29057803-29057825 GATTGGAAGCTGTTGGCCTGGGG + Exonic
930263825 2:49176858-49176880 GATTTGCTGATGTGGGCATCTGG + Intergenic
932834331 2:75021268-75021290 AATGGGAGCATGTTGGCATTTGG + Intergenic
933422331 2:82065441-82065463 GAATAGAGGTTGTTGGCATGGGG - Intergenic
933470046 2:82710549-82710571 TATTGGAGGCTGCTGGCATGGGG - Intergenic
933551835 2:83787551-83787573 GATTGCAGGCTTTTGGCATGGGG - Intergenic
933993345 2:87649458-87649480 GAGTGGAGGGTGTTGGCCTGGGG + Intergenic
935199631 2:100845069-100845091 GATTGGAGGCTGTTGGCATGGGG + Intronic
935329767 2:101968434-101968456 GATTGGAGGCTGTTGGTGTTGGG + Intergenic
936300512 2:111301425-111301447 GAGTGGAGGGTGTTGGCCTGGGG - Intergenic
940367350 2:152862859-152862881 GATTGGAGGCTGTTGGAGTAGGG + Intergenic
941908202 2:170737395-170737417 TATTGGAGGCTGCTGGCATTGGG - Intergenic
942636364 2:178011117-178011139 AAGTGGAGGTTGTTGGCATGGGG + Intronic
943189208 2:184654262-184654284 GCTTGGAGGTTTTTGGCATGGGG + Intronic
943363372 2:186946973-186946995 GATTTGGTGATGTTGCCATCAGG + Intergenic
945317341 2:208383950-208383972 GAATGGAGGATGGGGGCATGAGG + Intronic
946565274 2:220957388-220957410 GATTGGAGGTTGTCAGCATAGGG + Intergenic
946635384 2:221719339-221719361 GATTGGAGGTTGTTGGCATGGGG - Intergenic
946979845 2:225198538-225198560 GATTGGAGGTTGGTGGCAGGAGG - Intergenic
948434201 2:237941955-237941977 GATTGGAGGCTGTTGACCTAGGG + Intergenic
1169228981 20:3874532-3874554 GATTGGAGATTGTTGGCATGGGG + Exonic
1169280365 20:4262123-4262145 GATTGGAGGTTGTTGGCATGGGG + Intergenic
1169760619 20:9088589-9088611 GATTGCAGGATATTGGTCTCTGG + Intronic
1170053412 20:12172177-12172199 GATTGGAGGCTGCTGGCATGAGG + Intergenic
1170478384 20:16740051-16740073 GATTGGAGAATTTTGTCACCTGG - Intronic
1173794513 20:45849869-45849891 CATTGCAGGCTGTTGGCATGGGG + Intronic
1174907885 20:54571847-54571869 GATGGGAGGAAGTTGGCAACAGG - Intronic
1177378444 21:20304989-20305011 GATTGGAGGCTGTTAGCGTTGGG + Intergenic
1178368845 21:32010321-32010343 GACTGGAGGTTGTTGGCACAGGG + Intronic
1181409613 22:22709928-22709950 GAGGGGAAGCTGTTGGCATCAGG + Intergenic
1181526817 22:23494375-23494397 GATGGGAGGATGTTGCCTGCTGG - Intergenic
1182647339 22:31820955-31820977 GATTGAAGGAAGAGGGCATCTGG - Intronic
1183407230 22:37636307-37636329 GATGGGAGGCTATAGGCATCAGG - Intronic
1183642677 22:39101679-39101701 GGTTGGAGGAGGTTGGCAGGGGG + Intronic
949122691 3:405824-405846 AATTGCAGGATGTTGACTTCTGG - Exonic
949604548 3:5638853-5638875 GATTGGAGGCTGCTGGTGTCAGG + Intergenic
951312957 3:21151881-21151903 GATTGGAGGATGGTGACAGTTGG - Intergenic
953275019 3:41486542-41486564 GACTGGATGTTGTTGGCATGGGG + Intronic
953480759 3:43249891-43249913 GATTGGAGGCTGATAGCATGGGG - Intergenic
953744225 3:45560823-45560845 GATTGGCGGATGATGGCCTGTGG + Intronic
954896129 3:53976531-53976553 GACTGGAGGCTGTTGGCCTGGGG + Intergenic
955151450 3:56371358-56371380 GATTGGAGGTTGCTGGCTTGGGG - Intronic
955894982 3:63689302-63689324 TATTGGAGGCTGTTGGCACAAGG + Intergenic
959710652 3:109382752-109382774 GATTGGAGGCTATTGCCATGGGG - Intergenic
960145065 3:114192071-114192093 GATTGGAGGCTGGTGGCATGGGG + Intronic
960159703 3:114337082-114337104 GAATGGTGGCTGTTGGCATCTGG + Intergenic
962013914 3:131421371-131421393 GATTGGAAGTTGTTGGTATGGGG + Intergenic
962384616 3:134922815-134922837 GATTTGAGGCTGTTGGTGTCAGG + Intronic
962488413 3:135866931-135866953 GATTAGAGACTGTTGGCATGGGG + Intergenic
962819862 3:139038166-139038188 GATTGGAAGTTGCTGGCATAGGG + Intronic
963586859 3:147202807-147202829 CATTGGAGAATATTGGCATAGGG - Intergenic
964153963 3:153562860-153562882 GAATGGAGGAGGTTGGTATAGGG + Intergenic
964750256 3:160047842-160047864 GATTTGGTGATGTTGCCATCAGG + Intergenic
967775351 3:193380826-193380848 GAATGGGGGATAGTGGCATCTGG + Intergenic
967907754 3:194515869-194515891 GATTTGGAGATGTTGGCATATGG - Intergenic
970713406 4:18890969-18890991 GATTGAAGGTTGTTTGCCTCAGG + Intergenic
970860439 4:20696456-20696478 GCTTGGAGGAGTGTGGCATCTGG - Intronic
970897273 4:21118446-21118468 GATTGGAGGTTGTTGGCACAGGG - Intronic
971745336 4:30572551-30572573 GATAGGAGGCTGTTGGCCTGGGG - Intergenic
973587571 4:52408760-52408782 GATCAGAGGCTGTTGGCATCGGG + Intergenic
974036130 4:56820061-56820083 GATTGGAGGCTGTTGGCACAGGG - Intronic
978037584 4:104014778-104014800 GCCTTGAGGATGTTTGCATCGGG - Intergenic
978872540 4:113597255-113597277 TATTGGAGGAAGATGCCATCTGG - Intronic
979605727 4:122636876-122636898 GATTGGAGGGTGTTGTAATTGGG - Intergenic
980002558 4:127507530-127507552 GATTGTAGGTTGTTGTCATGGGG + Intergenic
980635577 4:135497604-135497626 TATTGGAAGAAGTTGCCATCTGG - Intergenic
982651500 4:158093253-158093275 GATTGAAGGAGGTTGGCACAGGG - Intergenic
1202765284 4_GL000008v2_random:144224-144246 GTCTGGAGGATGGTGGCATGGGG - Intergenic
986461390 5:7976003-7976025 GATTAGAGGCTGTTGGCCTGGGG - Intergenic
986541872 5:8852884-8852906 GACTGGAGGATGTTGGCCTGGGG - Intergenic
986661345 5:10062889-10062911 GATTGGAGGCTGCTGGCCTGAGG - Intergenic
986863305 5:11953079-11953101 GATTGGATGTTGTTGGCATGAGG + Intergenic
987964172 5:24850798-24850820 GATTGGAAGCTGTTGGCATGGGG - Intergenic
990601303 5:57361071-57361093 GATTGGAAGTTGCTGGCATGGGG + Intergenic
991225163 5:64261911-64261933 GATTGGATTCTGTTGGCATGGGG + Intronic
992226474 5:74623992-74624014 GATTGGAGGCCGTTGGCATGGGG + Intergenic
995087753 5:108134753-108134775 GCCTGGAGGATGTTGGAATTAGG - Intronic
995819322 5:116209972-116209994 GAGAGCAGGATGCTGGCATCTGG + Intronic
996662680 5:126022700-126022722 GATTGGAGGCTGTTAGCATGGGG + Intergenic
997940640 5:138154350-138154372 GAATGGAAGGTGTAGGCATCTGG - Intronic
998641815 5:144020325-144020347 GATTGGAGGTTGTTGGCATGGGG + Intergenic
1000371081 5:160537305-160537327 GATTGAAGGCTGTTGTCATGGGG + Intergenic
1001307311 5:170584844-170584866 GATGGGAGAATGTTAGCCTCTGG - Intronic
1001658015 5:173368829-173368851 GATGGGAGGAGGTTGGCAGCTGG + Intergenic
1003461584 6:6333768-6333790 GATTAGAGGCTGTTGGCATGAGG + Intergenic
1003830886 6:10010135-10010157 TATTGGAGGAAGATGGCATCTGG - Intronic
1006214336 6:32426779-32426801 GATTGGAGGCTGTTGGCATGGGG - Intergenic
1006379066 6:33687383-33687405 GACTGGGGGATGATGGCAGCTGG - Intronic
1006887451 6:37394596-37394618 AATTGGATGAGGTGGGCATCTGG - Exonic
1007157604 6:39760930-39760952 GACTGGAAGCTGTTGGCATGGGG - Intergenic
1007398089 6:41588578-41588600 GATGGGAGGATGGTGGCAGCAGG + Intronic
1008196925 6:48535885-48535907 GATTGGAGACTGTTGGCATGTGG - Intergenic
1009046031 6:58238305-58238327 GATTGGAAGGTGTTGGTATAAGG + Intergenic
1011157446 6:84348718-84348740 GTTTGGAGGCTGTTGGTATGGGG + Intergenic
1012655129 6:101807601-101807623 GATTGGAGATTGCTGGCATGAGG + Intronic
1013208541 6:107966322-107966344 GATTGCAGGTTGTTGGCATGGGG - Intergenic
1013972692 6:116039826-116039848 GAGGGGAGGATCTTGGCCTCAGG - Intronic
1014254528 6:119147860-119147882 GATGGGAGGCTGTTGGCCTGGGG - Intronic
1014557532 6:122852296-122852318 TATTGGAGGGTGTTGGCAACAGG + Intergenic
1014767242 6:125421109-125421131 GATTAGAGGCTGTTGGCATGGGG + Intergenic
1016710588 6:147166698-147166720 GATTGGAGGTTGCTGGCATGAGG - Intergenic
1016797920 6:148137649-148137671 GATTGGAGGGTTTTGGCATGGGG + Intergenic
1016849494 6:148602298-148602320 GGTTAGAAGCTGTTGGCATCAGG - Intergenic
1018017166 6:159723027-159723049 GATTGGAAGCTGTTGGCATGGGG - Intronic
1019870353 7:3755172-3755194 GATTGGAGGCTGTTGGCCTGGGG + Intronic
1022891485 7:34704734-34704756 GATTGGAGGCTGCTGGCCTAGGG + Intronic
1023076374 7:36486429-36486451 GATTAGAGGCTGTTGGCATGGGG - Intergenic
1027296184 7:76773719-76773741 TATTGGAAGATGATGCCATCTGG - Intergenic
1027749821 7:82128718-82128740 GATTAGTACATGTTGGCATCAGG - Intronic
1027959895 7:84931815-84931837 GATTGGAGATTGTTGGCATGGGG + Intergenic
1028583051 7:92426194-92426216 GATTAGGGGATCTGGGCATCTGG - Intergenic
1028781927 7:94746981-94747003 GATTGCAGGTTATTGGCATGGGG - Intergenic
1029218015 7:98965815-98965837 GCCCGGAGGATTTTGGCATCTGG - Exonic
1029661428 7:101964799-101964821 AATTGGAGGATGGTTGCATTTGG + Intronic
1033363422 7:140653858-140653880 AATTGGAAGATGTTGGCAGGGGG + Intronic
1034533844 7:151714461-151714483 GATGGGAGGATGGCGGCATGTGG - Intronic
1036422891 8:8614329-8614351 GATTGGAGACTGCTGGCATGGGG + Intergenic
1036610593 8:10346640-10346662 GATTGGAGGCTGTTGGCCTGGGG + Intronic
1037473754 8:19237083-19237105 GATTGGAGGCTGCTGGCGTCGGG - Intergenic
1038501089 8:28044467-28044489 GATTGGAGGCTGTTGGCCTGGGG + Intronic
1038843909 8:31211373-31211395 GATTGAAGGACGTTGGTATGGGG - Intergenic
1041158944 8:55017904-55017926 GAGTGGGGAACGTTGGCATCTGG + Intergenic
1042339890 8:67667456-67667478 ATTTGGATGATGTTGGCATGGGG - Intronic
1042832779 8:73050034-73050056 GCTTGGAGGGTGTTGGCATGAGG + Intergenic
1043516659 8:81001108-81001130 GGTGGGAGGGTTTTGGCATCAGG - Intronic
1043777995 8:84294806-84294828 GATTGGAGGTTGTTGGCATGGGG + Intronic
1044203461 8:89463731-89463753 GATTGGTGGCTGTTGGCATGGGG + Intergenic
1044552580 8:93528712-93528734 GTTTGGAGGTTGTTGGCATGAGG + Intergenic
1045059051 8:98396424-98396446 GAAAGAAGGTTGTTGGCATCTGG + Intergenic
1045572462 8:103382488-103382510 GATTAGTGGATGTTGCTATCTGG + Exonic
1045586809 8:103546818-103546840 GATTGGAGGATGGTAGGATGGGG - Intronic
1049254375 8:141605944-141605966 GCTGGGAGGCTGTGGGCATCAGG + Intergenic
1049436426 8:142588231-142588253 GTTTGGAGTATGTTTGCCTCAGG + Intergenic
1050343237 9:4662172-4662194 GAGGGGAGGATGTTGGCGTTGGG - Intronic
1052029238 9:23609732-23609754 GATTGGAGGCTGCTGGCATGGGG + Intergenic
1053286926 9:36855703-36855725 GAGTGGAGGATGTGGGCAGTGGG - Intronic
1054846679 9:69806042-69806064 GATTGGAGGGTTTTGGCATGGGG + Intergenic
1054952895 9:70872847-70872869 CATTGGAAAATGATGGCATCAGG + Intronic
1056438493 9:86596664-86596686 GATAGGAGGTTGTTGGCATGAGG + Intergenic
1058878729 9:109267833-109267855 GTTTGGAGTATTGTGGCATCAGG - Intronic
1059376894 9:113888983-113889005 GATTGGAGGATTTTTGCATGTGG - Intronic
1185992366 X:4905837-4905859 GATTAGAGGAAGGAGGCATCAGG + Intergenic
1186230748 X:7451005-7451027 AAGTGGAGGTGGTTGGCATCAGG - Intergenic
1188856446 X:35201878-35201900 GATTGGAGGTTGCTGGCATGGGG + Intergenic
1189463554 X:41261494-41261516 GATTGGAGAGTGTTGGCAGTGGG + Intergenic
1190146372 X:47895042-47895064 CTTTGGAGGATGTTGGGATGGGG + Intronic
1190276242 X:48901396-48901418 GGGTGGAGGGTGTTGGCATTAGG + Intronic
1190786476 X:53655550-53655572 ATTTTGAGGTTGTTGGCATCAGG - Intronic
1190916431 X:54814565-54814587 TAGTGGATGATGTTGCCATCTGG + Intronic
1190928267 X:54927582-54927604 GTTTGGAGGAGGTTGCCACCTGG + Intronic
1191721491 X:64232349-64232371 TATTGCAGGATGTTAGCATTGGG - Intergenic
1192129920 X:68539979-68540001 GATGAGAGCAGGTTGGCATCTGG - Intergenic
1192773554 X:74218333-74218355 GCTTGGACGTTGTTGGCAACTGG + Intergenic
1193426667 X:81348269-81348291 GATTGGAGGCTGTTGGCACGGGG - Intergenic
1196931493 X:120686002-120686024 GAGTGTAGAATGTGGGCATCTGG + Intergenic
1197267125 X:124386672-124386694 GATTCAAGTATGTTGGCAACAGG + Intronic
1199204173 X:145128345-145128367 GATTGGAGGTTGTTGGCATATGG - Intergenic
1199574275 X:149298274-149298296 GATTTAAGCATGTAGGCATCTGG - Intergenic
1199980925 X:152920081-152920103 AATGCGAGGATGTTGGCATCTGG + Intronic
1201222577 Y:11786398-11786420 GATTGGAGGCTCTTGACATAGGG - Intergenic